ID: 925531791

View in Genome Browser
Species Human (GRCh38)
Location 2:4871561-4871583
Sequence GAACACTTCTTTCCCAATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925531788_925531791 27 Left 925531788 2:4871511-4871533 CCTAGGCTTTAGATATTTTGGAT No data
Right 925531791 2:4871561-4871583 GAACACTTCTTTCCCAATGCAGG No data
925531790_925531791 -5 Left 925531790 2:4871543-4871565 CCGCTTCGTGCTAATGTGGAACA No data
Right 925531791 2:4871561-4871583 GAACACTTCTTTCCCAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925531791 Original CRISPR GAACACTTCTTTCCCAATGC AGG Intergenic
No off target data available for this crispr