ID: 925532143

View in Genome Browser
Species Human (GRCh38)
Location 2:4875886-4875908
Sequence TTGTCCAGCTGGTAGAGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925532143_925532145 24 Left 925532143 2:4875886-4875908 CCATTACTCTACCAGCTGGACAA No data
Right 925532145 2:4875933-4875955 TACTTAAGTCCAGAAGACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925532143 Original CRISPR TTGTCCAGCTGGTAGAGTAA TGG (reversed) Intergenic
No off target data available for this crispr