ID: 925535731

View in Genome Browser
Species Human (GRCh38)
Location 2:4914411-4914433
Sequence GCTTATGCATGAACTCGCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925535731_925535733 26 Left 925535731 2:4914411-4914433 CCTATGCGAGTTCATGCATAAGC No data
Right 925535733 2:4914460-4914482 CAGATTCACAGACTGTATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925535731 Original CRISPR GCTTATGCATGAACTCGCAT AGG (reversed) Intergenic
No off target data available for this crispr