ID: 925537143

View in Genome Browser
Species Human (GRCh38)
Location 2:4929963-4929985
Sequence TATCCAAGGAAACCCCAGAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925537141_925537143 26 Left 925537141 2:4929914-4929936 CCTTTAACAAATCATTTGTGAAA No data
Right 925537143 2:4929963-4929985 TATCCAAGGAAACCCCAGATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925537143 Original CRISPR TATCCAAGGAAACCCCAGAT CGG Intergenic
No off target data available for this crispr