ID: 925538308

View in Genome Browser
Species Human (GRCh38)
Location 2:4939652-4939674
Sequence TGTAACCTAGACCCCTTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925538305_925538308 14 Left 925538305 2:4939615-4939637 CCTCGGACCATCAGGCATTAGAT No data
Right 925538308 2:4939652-4939674 TGTAACCTAGACCCCTTGAATGG No data
925538306_925538308 7 Left 925538306 2:4939622-4939644 CCATCAGGCATTAGATTCTCATA 0: 23
1: 23
2: 18
3: 28
4: 130
Right 925538308 2:4939652-4939674 TGTAACCTAGACCCCTTGAATGG No data
925538304_925538308 17 Left 925538304 2:4939612-4939634 CCACCTCGGACCATCAGGCATTA No data
Right 925538308 2:4939652-4939674 TGTAACCTAGACCCCTTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925538308 Original CRISPR TGTAACCTAGACCCCTTGAA TGG Intergenic
No off target data available for this crispr