ID: 925540508

View in Genome Browser
Species Human (GRCh38)
Location 2:4961380-4961402
Sequence TGGTCCCTCCTCTGGGCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925540508_925540517 15 Left 925540508 2:4961380-4961402 CCTGTTGCCCAGAGGAGGGACCA No data
Right 925540517 2:4961418-4961440 CATCCCCTACAATGCAGGCTTGG No data
925540508_925540515 10 Left 925540508 2:4961380-4961402 CCTGTTGCCCAGAGGAGGGACCA No data
Right 925540515 2:4961413-4961435 TGAGCCATCCCCTACAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925540508 Original CRISPR TGGTCCCTCCTCTGGGCAAC AGG (reversed) Intergenic
No off target data available for this crispr