ID: 925540537

View in Genome Browser
Species Human (GRCh38)
Location 2:4961722-4961744
Sequence AGTAGTCAGTTCAATTAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925540537_925540542 8 Left 925540537 2:4961722-4961744 CCAAACTAATTGAACTGACTACT No data
Right 925540542 2:4961753-4961775 AGAATGAGTGGACTTCAGGAGGG No data
925540537_925540538 -4 Left 925540537 2:4961722-4961744 CCAAACTAATTGAACTGACTACT No data
Right 925540538 2:4961741-4961763 TACTCCTTTTATAGAATGAGTGG No data
925540537_925540540 4 Left 925540537 2:4961722-4961744 CCAAACTAATTGAACTGACTACT No data
Right 925540540 2:4961749-4961771 TTATAGAATGAGTGGACTTCAGG No data
925540537_925540541 7 Left 925540537 2:4961722-4961744 CCAAACTAATTGAACTGACTACT No data
Right 925540541 2:4961752-4961774 TAGAATGAGTGGACTTCAGGAGG No data
925540537_925540543 19 Left 925540537 2:4961722-4961744 CCAAACTAATTGAACTGACTACT No data
Right 925540543 2:4961764-4961786 ACTTCAGGAGGGTTTCTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925540537 Original CRISPR AGTAGTCAGTTCAATTAGTT TGG (reversed) Intergenic