ID: 925540539

View in Genome Browser
Species Human (GRCh38)
Location 2:4961745-4961767
Sequence AAGTCCACTCATTCTATAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925540539_925540543 -4 Left 925540539 2:4961745-4961767 CCTTTTATAGAATGAGTGGACTT No data
Right 925540543 2:4961764-4961786 ACTTCAGGAGGGTTTCTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925540539 Original CRISPR AAGTCCACTCATTCTATAAA AGG (reversed) Intergenic