ID: 925544574

View in Genome Browser
Species Human (GRCh38)
Location 2:5003316-5003338
Sequence GTTCCCACACAGATGGGACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925544574_925544582 29 Left 925544574 2:5003316-5003338 CCGTGTCCCATCTGTGTGGGAAC No data
Right 925544582 2:5003368-5003390 GCAGCCACTCCCAGCGCCCCTGG 0: 4
1: 501
2: 279
3: 124
4: 403
925544574_925544580 7 Left 925544574 2:5003316-5003338 CCGTGTCCCATCTGTGTGGGAAC No data
Right 925544580 2:5003346-5003368 AAATCAGACTTCAACTCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925544574 Original CRISPR GTTCCCACACAGATGGGACA CGG (reversed) Intergenic
No off target data available for this crispr