ID: 925545568

View in Genome Browser
Species Human (GRCh38)
Location 2:5012237-5012259
Sequence CTGTCTCAGTGACAAGTAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925545564_925545568 28 Left 925545564 2:5012186-5012208 CCAGCTCACTAAATCAATCACTG No data
Right 925545568 2:5012237-5012259 CTGTCTCAGTGACAAGTAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925545568 Original CRISPR CTGTCTCAGTGACAAGTAGT AGG Intergenic
No off target data available for this crispr