ID: 925546025

View in Genome Browser
Species Human (GRCh38)
Location 2:5017677-5017699
Sequence ATTCCATGGGACCTGTGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925546022_925546025 8 Left 925546022 2:5017646-5017668 CCTCTGGGAAGATAGATAACAAA No data
Right 925546025 2:5017677-5017699 ATTCCATGGGACCTGTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925546025 Original CRISPR ATTCCATGGGACCTGTGTGA AGG Intergenic
No off target data available for this crispr