ID: 925550981

View in Genome Browser
Species Human (GRCh38)
Location 2:5074135-5074157
Sequence TTAGTATTCCCCATCTTCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925550981_925550984 5 Left 925550981 2:5074135-5074157 CCTATGAAGATGGGGAATACTAA No data
Right 925550984 2:5074163-5074185 CTCCATAAGTGTATGACACTTGG No data
925550981_925550985 6 Left 925550981 2:5074135-5074157 CCTATGAAGATGGGGAATACTAA No data
Right 925550985 2:5074164-5074186 TCCATAAGTGTATGACACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925550981 Original CRISPR TTAGTATTCCCCATCTTCAT AGG (reversed) Intergenic
No off target data available for this crispr