ID: 925553270

View in Genome Browser
Species Human (GRCh38)
Location 2:5099353-5099375
Sequence AACCCAGCAGTTCCACCGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925553270_925553272 8 Left 925553270 2:5099353-5099375 CCTCACGGTGGAACTGCTGGGTT No data
Right 925553272 2:5099384-5099406 ATTCTCTGCTTCATCATTTGAGG No data
925553270_925553273 9 Left 925553270 2:5099353-5099375 CCTCACGGTGGAACTGCTGGGTT No data
Right 925553273 2:5099385-5099407 TTCTCTGCTTCATCATTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925553270 Original CRISPR AACCCAGCAGTTCCACCGTG AGG (reversed) Intergenic
No off target data available for this crispr