ID: 925556279

View in Genome Browser
Species Human (GRCh38)
Location 2:5134574-5134596
Sequence TGCCTCACCATGGAAAGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925556279_925556283 -7 Left 925556279 2:5134574-5134596 CCTGTTCTTTCCATGGTGAGGCA No data
Right 925556283 2:5134590-5134612 TGAGGCATCTCCAGGAGCCCGGG No data
925556279_925556293 22 Left 925556279 2:5134574-5134596 CCTGTTCTTTCCATGGTGAGGCA No data
Right 925556293 2:5134619-5134641 CCAGGGCCCTCAGCAGGAGGAGG No data
925556279_925556294 23 Left 925556279 2:5134574-5134596 CCTGTTCTTTCCATGGTGAGGCA No data
Right 925556294 2:5134620-5134642 CAGGGCCCTCAGCAGGAGGAGGG No data
925556279_925556290 16 Left 925556279 2:5134574-5134596 CCTGTTCTTTCCATGGTGAGGCA No data
Right 925556290 2:5134613-5134635 GATCAGCCAGGGCCCTCAGCAGG No data
925556279_925556282 -8 Left 925556279 2:5134574-5134596 CCTGTTCTTTCCATGGTGAGGCA No data
Right 925556282 2:5134589-5134611 GTGAGGCATCTCCAGGAGCCCGG No data
925556279_925556287 5 Left 925556279 2:5134574-5134596 CCTGTTCTTTCCATGGTGAGGCA No data
Right 925556287 2:5134602-5134624 AGGAGCCCGGGGATCAGCCAGGG No data
925556279_925556291 19 Left 925556279 2:5134574-5134596 CCTGTTCTTTCCATGGTGAGGCA No data
Right 925556291 2:5134616-5134638 CAGCCAGGGCCCTCAGCAGGAGG No data
925556279_925556286 4 Left 925556279 2:5134574-5134596 CCTGTTCTTTCCATGGTGAGGCA No data
Right 925556286 2:5134601-5134623 CAGGAGCCCGGGGATCAGCCAGG No data
925556279_925556295 24 Left 925556279 2:5134574-5134596 CCTGTTCTTTCCATGGTGAGGCA No data
Right 925556295 2:5134621-5134643 AGGGCCCTCAGCAGGAGGAGGGG No data
925556279_925556284 -6 Left 925556279 2:5134574-5134596 CCTGTTCTTTCCATGGTGAGGCA No data
Right 925556284 2:5134591-5134613 GAGGCATCTCCAGGAGCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925556279 Original CRISPR TGCCTCACCATGGAAAGAAC AGG (reversed) Intergenic
No off target data available for this crispr