ID: 925556281

View in Genome Browser
Species Human (GRCh38)
Location 2:5134584-5134606
Sequence CTCCTGGAGATGCCTCACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925556281_925556294 13 Left 925556281 2:5134584-5134606 CCATGGTGAGGCATCTCCAGGAG No data
Right 925556294 2:5134620-5134642 CAGGGCCCTCAGCAGGAGGAGGG No data
925556281_925556295 14 Left 925556281 2:5134584-5134606 CCATGGTGAGGCATCTCCAGGAG No data
Right 925556295 2:5134621-5134643 AGGGCCCTCAGCAGGAGGAGGGG No data
925556281_925556287 -5 Left 925556281 2:5134584-5134606 CCATGGTGAGGCATCTCCAGGAG No data
Right 925556287 2:5134602-5134624 AGGAGCCCGGGGATCAGCCAGGG No data
925556281_925556286 -6 Left 925556281 2:5134584-5134606 CCATGGTGAGGCATCTCCAGGAG No data
Right 925556286 2:5134601-5134623 CAGGAGCCCGGGGATCAGCCAGG No data
925556281_925556290 6 Left 925556281 2:5134584-5134606 CCATGGTGAGGCATCTCCAGGAG No data
Right 925556290 2:5134613-5134635 GATCAGCCAGGGCCCTCAGCAGG No data
925556281_925556293 12 Left 925556281 2:5134584-5134606 CCATGGTGAGGCATCTCCAGGAG No data
Right 925556293 2:5134619-5134641 CCAGGGCCCTCAGCAGGAGGAGG No data
925556281_925556291 9 Left 925556281 2:5134584-5134606 CCATGGTGAGGCATCTCCAGGAG No data
Right 925556291 2:5134616-5134638 CAGCCAGGGCCCTCAGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925556281 Original CRISPR CTCCTGGAGATGCCTCACCA TGG (reversed) Intergenic
No off target data available for this crispr