ID: 925556285

View in Genome Browser
Species Human (GRCh38)
Location 2:5134600-5134622
Sequence CTGGCTGATCCCCGGGCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925556285_925556294 -3 Left 925556285 2:5134600-5134622 CCAGGAGCCCGGGGATCAGCCAG No data
Right 925556294 2:5134620-5134642 CAGGGCCCTCAGCAGGAGGAGGG No data
925556285_925556290 -10 Left 925556285 2:5134600-5134622 CCAGGAGCCCGGGGATCAGCCAG No data
Right 925556290 2:5134613-5134635 GATCAGCCAGGGCCCTCAGCAGG No data
925556285_925556293 -4 Left 925556285 2:5134600-5134622 CCAGGAGCCCGGGGATCAGCCAG No data
Right 925556293 2:5134619-5134641 CCAGGGCCCTCAGCAGGAGGAGG No data
925556285_925556295 -2 Left 925556285 2:5134600-5134622 CCAGGAGCCCGGGGATCAGCCAG No data
Right 925556295 2:5134621-5134643 AGGGCCCTCAGCAGGAGGAGGGG No data
925556285_925556291 -7 Left 925556285 2:5134600-5134622 CCAGGAGCCCGGGGATCAGCCAG No data
Right 925556291 2:5134616-5134638 CAGCCAGGGCCCTCAGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925556285 Original CRISPR CTGGCTGATCCCCGGGCTCC TGG (reversed) Intergenic
No off target data available for this crispr