ID: 925556288

View in Genome Browser
Species Human (GRCh38)
Location 2:5134607-5134629
Sequence GAGGGCCCTGGCTGATCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925556288_925556295 -9 Left 925556288 2:5134607-5134629 CCCGGGGATCAGCCAGGGCCCTC No data
Right 925556295 2:5134621-5134643 AGGGCCCTCAGCAGGAGGAGGGG No data
925556288_925556294 -10 Left 925556288 2:5134607-5134629 CCCGGGGATCAGCCAGGGCCCTC No data
Right 925556294 2:5134620-5134642 CAGGGCCCTCAGCAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925556288 Original CRISPR GAGGGCCCTGGCTGATCCCC GGG (reversed) Intergenic
No off target data available for this crispr