ID: 925556294

View in Genome Browser
Species Human (GRCh38)
Location 2:5134620-5134642
Sequence CAGGGCCCTCAGCAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925556279_925556294 23 Left 925556279 2:5134574-5134596 CCTGTTCTTTCCATGGTGAGGCA No data
Right 925556294 2:5134620-5134642 CAGGGCCCTCAGCAGGAGGAGGG No data
925556281_925556294 13 Left 925556281 2:5134584-5134606 CCATGGTGAGGCATCTCCAGGAG No data
Right 925556294 2:5134620-5134642 CAGGGCCCTCAGCAGGAGGAGGG No data
925556285_925556294 -3 Left 925556285 2:5134600-5134622 CCAGGAGCCCGGGGATCAGCCAG No data
Right 925556294 2:5134620-5134642 CAGGGCCCTCAGCAGGAGGAGGG No data
925556288_925556294 -10 Left 925556288 2:5134607-5134629 CCCGGGGATCAGCCAGGGCCCTC No data
Right 925556294 2:5134620-5134642 CAGGGCCCTCAGCAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925556294 Original CRISPR CAGGGCCCTCAGCAGGAGGA GGG Intergenic
No off target data available for this crispr