ID: 925556534

View in Genome Browser
Species Human (GRCh38)
Location 2:5136920-5136942
Sequence CTTCTCTGCCCTTTGGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925556531_925556534 -2 Left 925556531 2:5136899-5136921 CCTGGGTTCTGCTCACACTTCCT No data
Right 925556534 2:5136920-5136942 CTTCTCTGCCCTTTGGCTGCAGG No data
925556530_925556534 10 Left 925556530 2:5136887-5136909 CCACTTTTTCTGCCTGGGTTCTG No data
Right 925556534 2:5136920-5136942 CTTCTCTGCCCTTTGGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925556534 Original CRISPR CTTCTCTGCCCTTTGGCTGC AGG Intergenic
No off target data available for this crispr