ID: 925559108

View in Genome Browser
Species Human (GRCh38)
Location 2:5168785-5168807
Sequence TGGCTTCATGGAAAGACTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925559108_925559114 19 Left 925559108 2:5168785-5168807 CCAAAAGTCTTTCCATGAAGCCA No data
Right 925559114 2:5168827-5168849 GGTCCCAGTGTAGCAGAAGCAGG No data
925559108_925559115 20 Left 925559108 2:5168785-5168807 CCAAAAGTCTTTCCATGAAGCCA No data
Right 925559115 2:5168828-5168850 GTCCCAGTGTAGCAGAAGCAGGG No data
925559108_925559113 -2 Left 925559108 2:5168785-5168807 CCAAAAGTCTTTCCATGAAGCCA No data
Right 925559113 2:5168806-5168828 CATAGTATGCACTGAGGGAGAGG No data
925559108_925559111 -7 Left 925559108 2:5168785-5168807 CCAAAAGTCTTTCCATGAAGCCA No data
Right 925559111 2:5168801-5168823 GAAGCCATAGTATGCACTGAGGG No data
925559108_925559110 -8 Left 925559108 2:5168785-5168807 CCAAAAGTCTTTCCATGAAGCCA No data
Right 925559110 2:5168800-5168822 TGAAGCCATAGTATGCACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925559108 Original CRISPR TGGCTTCATGGAAAGACTTT TGG (reversed) Intergenic
No off target data available for this crispr