ID: 925559109

View in Genome Browser
Species Human (GRCh38)
Location 2:5168797-5168819
Sequence CAGTGCATACTATGGCTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925559109_925559115 8 Left 925559109 2:5168797-5168819 CCATGAAGCCATAGTATGCACTG No data
Right 925559115 2:5168828-5168850 GTCCCAGTGTAGCAGAAGCAGGG No data
925559109_925559118 20 Left 925559109 2:5168797-5168819 CCATGAAGCCATAGTATGCACTG No data
Right 925559118 2:5168840-5168862 CAGAAGCAGGGCAGTAAGTCTGG No data
925559109_925559114 7 Left 925559109 2:5168797-5168819 CCATGAAGCCATAGTATGCACTG No data
Right 925559114 2:5168827-5168849 GGTCCCAGTGTAGCAGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925559109 Original CRISPR CAGTGCATACTATGGCTTCA TGG (reversed) Intergenic
No off target data available for this crispr