ID: 925559112

View in Genome Browser
Species Human (GRCh38)
Location 2:5168805-5168827
Sequence CTCTCCCTCAGTGCATACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925559112_925559114 -1 Left 925559112 2:5168805-5168827 CCATAGTATGCACTGAGGGAGAG No data
Right 925559114 2:5168827-5168849 GGTCCCAGTGTAGCAGAAGCAGG No data
925559112_925559118 12 Left 925559112 2:5168805-5168827 CCATAGTATGCACTGAGGGAGAG No data
Right 925559118 2:5168840-5168862 CAGAAGCAGGGCAGTAAGTCTGG No data
925559112_925559115 0 Left 925559112 2:5168805-5168827 CCATAGTATGCACTGAGGGAGAG No data
Right 925559115 2:5168828-5168850 GTCCCAGTGTAGCAGAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925559112 Original CRISPR CTCTCCCTCAGTGCATACTA TGG (reversed) Intergenic
No off target data available for this crispr