ID: 925559114

View in Genome Browser
Species Human (GRCh38)
Location 2:5168827-5168849
Sequence GGTCCCAGTGTAGCAGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925559108_925559114 19 Left 925559108 2:5168785-5168807 CCAAAAGTCTTTCCATGAAGCCA No data
Right 925559114 2:5168827-5168849 GGTCCCAGTGTAGCAGAAGCAGG No data
925559112_925559114 -1 Left 925559112 2:5168805-5168827 CCATAGTATGCACTGAGGGAGAG No data
Right 925559114 2:5168827-5168849 GGTCCCAGTGTAGCAGAAGCAGG No data
925559109_925559114 7 Left 925559109 2:5168797-5168819 CCATGAAGCCATAGTATGCACTG No data
Right 925559114 2:5168827-5168849 GGTCCCAGTGTAGCAGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925559114 Original CRISPR GGTCCCAGTGTAGCAGAAGC AGG Intergenic
No off target data available for this crispr