ID: 925568473

View in Genome Browser
Species Human (GRCh38)
Location 2:5283123-5283145
Sequence TCCTATATGCAGAAGCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925568470_925568473 0 Left 925568470 2:5283100-5283122 CCTTGACTTCAACCTATTAGCTG No data
Right 925568473 2:5283123-5283145 TCCTATATGCAGAAGCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925568473 Original CRISPR TCCTATATGCAGAAGCTGGA AGG Intergenic
No off target data available for this crispr