ID: 925569882

View in Genome Browser
Species Human (GRCh38)
Location 2:5297891-5297913
Sequence ATGCTGCGCAGCTCTGGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925569882_925569889 26 Left 925569882 2:5297891-5297913 CCAAATCCAGAGCTGCGCAGCAT No data
Right 925569889 2:5297940-5297962 GAGAAGCAGAAATCAGCTCAAGG No data
925569882_925569890 27 Left 925569882 2:5297891-5297913 CCAAATCCAGAGCTGCGCAGCAT No data
Right 925569890 2:5297941-5297963 AGAAGCAGAAATCAGCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925569882 Original CRISPR ATGCTGCGCAGCTCTGGATT TGG (reversed) Intergenic
No off target data available for this crispr