ID: 925571181

View in Genome Browser
Species Human (GRCh38)
Location 2:5314242-5314264
Sequence CCGCAAGTACTGAAGGTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925571171_925571181 29 Left 925571171 2:5314190-5314212 CCAAGGAGTTGCTGGAAGCCGAG No data
Right 925571181 2:5314242-5314264 CCGCAAGTACTGAAGGTGTTGGG No data
925571170_925571181 30 Left 925571170 2:5314189-5314211 CCCAAGGAGTTGCTGGAAGCCGA No data
Right 925571181 2:5314242-5314264 CCGCAAGTACTGAAGGTGTTGGG No data
925571177_925571181 -4 Left 925571177 2:5314223-5314245 CCTGCAGGAGACTGGGAATCCGC No data
Right 925571181 2:5314242-5314264 CCGCAAGTACTGAAGGTGTTGGG No data
925571173_925571181 11 Left 925571173 2:5314208-5314230 CCGAGTGTGGATGCACCTGCAGG No data
Right 925571181 2:5314242-5314264 CCGCAAGTACTGAAGGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925571181 Original CRISPR CCGCAAGTACTGAAGGTGTT GGG Intergenic
No off target data available for this crispr