ID: 925571718

View in Genome Browser
Species Human (GRCh38)
Location 2:5319386-5319408
Sequence CAGGTTACATGCTCTGTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925571718_925571728 10 Left 925571718 2:5319386-5319408 CCCCCTACAGAGCATGTAACCTG No data
Right 925571728 2:5319419-5319441 AGCTTCAGGTGGGAGAAACTTGG No data
925571718_925571724 -4 Left 925571718 2:5319386-5319408 CCCCCTACAGAGCATGTAACCTG No data
Right 925571724 2:5319405-5319427 CCTGGCCGTGTCTCAGCTTCAGG No data
925571718_925571726 0 Left 925571718 2:5319386-5319408 CCCCCTACAGAGCATGTAACCTG No data
Right 925571726 2:5319409-5319431 GCCGTGTCTCAGCTTCAGGTGGG No data
925571718_925571729 11 Left 925571718 2:5319386-5319408 CCCCCTACAGAGCATGTAACCTG No data
Right 925571729 2:5319420-5319442 GCTTCAGGTGGGAGAAACTTGGG No data
925571718_925571725 -1 Left 925571718 2:5319386-5319408 CCCCCTACAGAGCATGTAACCTG No data
Right 925571725 2:5319408-5319430 GGCCGTGTCTCAGCTTCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925571718 Original CRISPR CAGGTTACATGCTCTGTAGG GGG (reversed) Intergenic
No off target data available for this crispr