ID: 925578052

View in Genome Browser
Species Human (GRCh38)
Location 2:5380975-5380997
Sequence CTTGTTGCCCAGGCTGGACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925578052_925578059 17 Left 925578052 2:5380975-5380997 CCGTGTCCAGCCTGGGCAACAAG No data
Right 925578059 2:5381015-5381037 AAAAAAAAAAAAAAAGTATTAGG 0: 31
1: 657
2: 5860
3: 31565
4: 101689

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925578052 Original CRISPR CTTGTTGCCCAGGCTGGACA CGG (reversed) Intergenic
No off target data available for this crispr