ID: 925581361

View in Genome Browser
Species Human (GRCh38)
Location 2:5414672-5414694
Sequence ACTTGTGACCAAAAGGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925581356_925581361 29 Left 925581356 2:5414620-5414642 CCAATCAGTATATATCCAACAAA No data
Right 925581361 2:5414672-5414694 ACTTGTGACCAAAAGGAAATGGG No data
925581357_925581361 14 Left 925581357 2:5414635-5414657 CCAACAAAAGCCAATTAGATCTA No data
Right 925581361 2:5414672-5414694 ACTTGTGACCAAAAGGAAATGGG No data
925581358_925581361 4 Left 925581358 2:5414645-5414667 CCAATTAGATCTACGAAAACATA No data
Right 925581361 2:5414672-5414694 ACTTGTGACCAAAAGGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925581361 Original CRISPR ACTTGTGACCAAAAGGAAAT GGG Intergenic
No off target data available for this crispr