ID: 925584766

View in Genome Browser
Species Human (GRCh38)
Location 2:5453565-5453587
Sequence GTTCCTGCCTTTCCTAGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925584765_925584766 16 Left 925584765 2:5453526-5453548 CCACTATTCATATTCACATTTGA No data
Right 925584766 2:5453565-5453587 GTTCCTGCCTTTCCTAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925584766 Original CRISPR GTTCCTGCCTTTCCTAGACC TGG Intergenic
No off target data available for this crispr