ID: 925585725

View in Genome Browser
Species Human (GRCh38)
Location 2:5462097-5462119
Sequence CAGGATGAGCTGAAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925585719_925585725 5 Left 925585719 2:5462069-5462091 CCGAACTAAGAGGGTGCAAGAGA No data
Right 925585725 2:5462097-5462119 CAGGATGAGCTGAAGGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925585725 Original CRISPR CAGGATGAGCTGAAGGTGGG AGG Intergenic
No off target data available for this crispr