ID: 925588464

View in Genome Browser
Species Human (GRCh38)
Location 2:5486905-5486927
Sequence GATTCTCTCTCCACACAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925588464_925588467 -10 Left 925588464 2:5486905-5486927 CCACATTGTGTGGAGAGAGAATC No data
Right 925588467 2:5486918-5486940 AGAGAGAATCTGTAAGCTTGGGG No data
925588464_925588472 23 Left 925588464 2:5486905-5486927 CCACATTGTGTGGAGAGAGAATC No data
Right 925588472 2:5486951-5486973 GCAGTGATTATGGGACAGCTGGG No data
925588464_925588469 13 Left 925588464 2:5486905-5486927 CCACATTGTGTGGAGAGAGAATC No data
Right 925588469 2:5486941-5486963 GAGAGAGAGTGCAGTGATTATGG No data
925588464_925588470 14 Left 925588464 2:5486905-5486927 CCACATTGTGTGGAGAGAGAATC No data
Right 925588470 2:5486942-5486964 AGAGAGAGTGCAGTGATTATGGG No data
925588464_925588468 -9 Left 925588464 2:5486905-5486927 CCACATTGTGTGGAGAGAGAATC No data
Right 925588468 2:5486919-5486941 GAGAGAATCTGTAAGCTTGGGGG No data
925588464_925588471 22 Left 925588464 2:5486905-5486927 CCACATTGTGTGGAGAGAGAATC No data
Right 925588471 2:5486950-5486972 TGCAGTGATTATGGGACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925588464 Original CRISPR GATTCTCTCTCCACACAATG TGG (reversed) Intergenic
No off target data available for this crispr