ID: 925588470

View in Genome Browser
Species Human (GRCh38)
Location 2:5486942-5486964
Sequence AGAGAGAGTGCAGTGATTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925588464_925588470 14 Left 925588464 2:5486905-5486927 CCACATTGTGTGGAGAGAGAATC No data
Right 925588470 2:5486942-5486964 AGAGAGAGTGCAGTGATTATGGG No data
925588462_925588470 25 Left 925588462 2:5486894-5486916 CCTGGCAGCAGCCACATTGTGTG No data
Right 925588470 2:5486942-5486964 AGAGAGAGTGCAGTGATTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925588470 Original CRISPR AGAGAGAGTGCAGTGATTAT GGG Intergenic
No off target data available for this crispr