ID: 925589119

View in Genome Browser
Species Human (GRCh38)
Location 2:5492881-5492903
Sequence TGCCACAGGGACGTGTGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925589119_925589124 4 Left 925589119 2:5492881-5492903 CCCCATCACACGTCCCTGTGGCA No data
Right 925589124 2:5492908-5492930 GCACATTCTTCCCATAGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925589119 Original CRISPR TGCCACAGGGACGTGTGATG GGG (reversed) Intergenic
No off target data available for this crispr