ID: 925590404

View in Genome Browser
Species Human (GRCh38)
Location 2:5503482-5503504
Sequence ATGAAGTTCTTCAAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925590404_925590408 -7 Left 925590404 2:5503482-5503504 CCTTCTTCCTTGAAGAACTTCAT No data
Right 925590408 2:5503498-5503520 ACTTCATGTGGCAGGTGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925590404 Original CRISPR ATGAAGTTCTTCAAGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr