ID: 925591205

View in Genome Browser
Species Human (GRCh38)
Location 2:5511789-5511811
Sequence CCCAGATTGTTCCCAACTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925591202_925591205 9 Left 925591202 2:5511757-5511779 CCAGGGAGGTGGGCTTCACAGCT No data
Right 925591205 2:5511789-5511811 CCCAGATTGTTCCCAACTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925591205 Original CRISPR CCCAGATTGTTCCCAACTAC AGG Intergenic
No off target data available for this crispr