ID: 925592874

View in Genome Browser
Species Human (GRCh38)
Location 2:5527418-5527440
Sequence GTCACAACATCCGTCTGTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925592874_925592877 5 Left 925592874 2:5527418-5527440 CCTTAACAGACGGATGTTGTGAC No data
Right 925592877 2:5527446-5527468 TTCAGTTTGCCCGAGAAGAAGGG No data
925592874_925592876 4 Left 925592874 2:5527418-5527440 CCTTAACAGACGGATGTTGTGAC No data
Right 925592876 2:5527445-5527467 CTTCAGTTTGCCCGAGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925592874 Original CRISPR GTCACAACATCCGTCTGTTA AGG (reversed) Intergenic