ID: 925600049

View in Genome Browser
Species Human (GRCh38)
Location 2:5598903-5598925
Sequence CTGCTTTTGTTGGTGAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925600040_925600049 23 Left 925600040 2:5598857-5598879 CCTTCAGGGACCCTCATGTAGGG No data
Right 925600049 2:5598903-5598925 CTGCTTTTGTTGGTGAAACAAGG No data
925600038_925600049 24 Left 925600038 2:5598856-5598878 CCCTTCAGGGACCCTCATGTAGG No data
Right 925600049 2:5598903-5598925 CTGCTTTTGTTGGTGAAACAAGG No data
925600044_925600049 13 Left 925600044 2:5598867-5598889 CCCTCATGTAGGGCTTAGAGGGG No data
Right 925600049 2:5598903-5598925 CTGCTTTTGTTGGTGAAACAAGG No data
925600046_925600049 12 Left 925600046 2:5598868-5598890 CCTCATGTAGGGCTTAGAGGGGA No data
Right 925600049 2:5598903-5598925 CTGCTTTTGTTGGTGAAACAAGG No data
925600037_925600049 25 Left 925600037 2:5598855-5598877 CCCCTTCAGGGACCCTCATGTAG No data
Right 925600049 2:5598903-5598925 CTGCTTTTGTTGGTGAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925600049 Original CRISPR CTGCTTTTGTTGGTGAAACA AGG Intergenic
No off target data available for this crispr