ID: 925604011

View in Genome Browser
Species Human (GRCh38)
Location 2:5639799-5639821
Sequence TTATTCACCTTGTGGTTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925604011_925604017 14 Left 925604011 2:5639799-5639821 CCCAGAAACCACAAGGTGAATAA No data
Right 925604017 2:5639836-5639858 GAAGGTCCACCATGAAGATAAGG No data
925604011_925604020 29 Left 925604011 2:5639799-5639821 CCCAGAAACCACAAGGTGAATAA No data
Right 925604020 2:5639851-5639873 AGATAAGGACTTAATCTATCAGG No data
925604011_925604014 -4 Left 925604011 2:5639799-5639821 CCCAGAAACCACAAGGTGAATAA No data
Right 925604014 2:5639818-5639840 ATAATAGCACCCAGAACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925604011 Original CRISPR TTATTCACCTTGTGGTTTCT GGG (reversed) Intergenic
No off target data available for this crispr