ID: 925604012

View in Genome Browser
Species Human (GRCh38)
Location 2:5639800-5639822
Sequence ATTATTCACCTTGTGGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925604012_925604014 -5 Left 925604012 2:5639800-5639822 CCAGAAACCACAAGGTGAATAAT No data
Right 925604014 2:5639818-5639840 ATAATAGCACCCAGAACAGAAGG No data
925604012_925604020 28 Left 925604012 2:5639800-5639822 CCAGAAACCACAAGGTGAATAAT No data
Right 925604020 2:5639851-5639873 AGATAAGGACTTAATCTATCAGG No data
925604012_925604017 13 Left 925604012 2:5639800-5639822 CCAGAAACCACAAGGTGAATAAT No data
Right 925604017 2:5639836-5639858 GAAGGTCCACCATGAAGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925604012 Original CRISPR ATTATTCACCTTGTGGTTTC TGG (reversed) Intergenic
No off target data available for this crispr