ID: 925604013

View in Genome Browser
Species Human (GRCh38)
Location 2:5639807-5639829
Sequence GGGTGCTATTATTCACCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925604013_925604017 6 Left 925604013 2:5639807-5639829 CCACAAGGTGAATAATAGCACCC No data
Right 925604017 2:5639836-5639858 GAAGGTCCACCATGAAGATAAGG No data
925604013_925604021 25 Left 925604013 2:5639807-5639829 CCACAAGGTGAATAATAGCACCC No data
Right 925604021 2:5639855-5639877 AAGGACTTAATCTATCAGGAAGG No data
925604013_925604020 21 Left 925604013 2:5639807-5639829 CCACAAGGTGAATAATAGCACCC No data
Right 925604020 2:5639851-5639873 AGATAAGGACTTAATCTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925604013 Original CRISPR GGGTGCTATTATTCACCTTG TGG (reversed) Intergenic
No off target data available for this crispr