ID: 925604016

View in Genome Browser
Species Human (GRCh38)
Location 2:5639828-5639850
Sequence TCATGGTGGACCTTCTGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925604016_925604022 29 Left 925604016 2:5639828-5639850 CCAGAACAGAAGGTCCACCATGA No data
Right 925604022 2:5639880-5639902 TAAATGTAACCGTCAAGAGTAGG No data
925604016_925604020 0 Left 925604016 2:5639828-5639850 CCAGAACAGAAGGTCCACCATGA No data
Right 925604020 2:5639851-5639873 AGATAAGGACTTAATCTATCAGG No data
925604016_925604021 4 Left 925604016 2:5639828-5639850 CCAGAACAGAAGGTCCACCATGA No data
Right 925604021 2:5639855-5639877 AAGGACTTAATCTATCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925604016 Original CRISPR TCATGGTGGACCTTCTGTTC TGG (reversed) Intergenic
No off target data available for this crispr