ID: 925604017

View in Genome Browser
Species Human (GRCh38)
Location 2:5639836-5639858
Sequence GAAGGTCCACCATGAAGATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925604013_925604017 6 Left 925604013 2:5639807-5639829 CCACAAGGTGAATAATAGCACCC No data
Right 925604017 2:5639836-5639858 GAAGGTCCACCATGAAGATAAGG No data
925604011_925604017 14 Left 925604011 2:5639799-5639821 CCCAGAAACCACAAGGTGAATAA No data
Right 925604017 2:5639836-5639858 GAAGGTCCACCATGAAGATAAGG No data
925604009_925604017 23 Left 925604009 2:5639790-5639812 CCAAGACAGCCCAGAAACCACAA No data
Right 925604017 2:5639836-5639858 GAAGGTCCACCATGAAGATAAGG No data
925604012_925604017 13 Left 925604012 2:5639800-5639822 CCAGAAACCACAAGGTGAATAAT No data
Right 925604017 2:5639836-5639858 GAAGGTCCACCATGAAGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925604017 Original CRISPR GAAGGTCCACCATGAAGATA AGG Intergenic
No off target data available for this crispr