ID: 925604018

View in Genome Browser
Species Human (GRCh38)
Location 2:5639842-5639864
Sequence TTAAGTCCTTATCTTCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925604018_925604023 23 Left 925604018 2:5639842-5639864 CCACCATGAAGATAAGGACTTAA No data
Right 925604023 2:5639888-5639910 ACCGTCAAGAGTAGGCTTGATGG No data
925604018_925604021 -10 Left 925604018 2:5639842-5639864 CCACCATGAAGATAAGGACTTAA No data
Right 925604021 2:5639855-5639877 AAGGACTTAATCTATCAGGAAGG No data
925604018_925604025 26 Left 925604018 2:5639842-5639864 CCACCATGAAGATAAGGACTTAA No data
Right 925604025 2:5639891-5639913 GTCAAGAGTAGGCTTGATGGAGG No data
925604018_925604022 15 Left 925604018 2:5639842-5639864 CCACCATGAAGATAAGGACTTAA No data
Right 925604022 2:5639880-5639902 TAAATGTAACCGTCAAGAGTAGG No data
925604018_925604026 29 Left 925604018 2:5639842-5639864 CCACCATGAAGATAAGGACTTAA No data
Right 925604026 2:5639894-5639916 AAGAGTAGGCTTGATGGAGGAGG No data
925604018_925604027 30 Left 925604018 2:5639842-5639864 CCACCATGAAGATAAGGACTTAA No data
Right 925604027 2:5639895-5639917 AGAGTAGGCTTGATGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925604018 Original CRISPR TTAAGTCCTTATCTTCATGG TGG (reversed) Intergenic
No off target data available for this crispr