ID: 925604020

View in Genome Browser
Species Human (GRCh38)
Location 2:5639851-5639873
Sequence AGATAAGGACTTAATCTATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925604015_925604020 1 Left 925604015 2:5639827-5639849 CCCAGAACAGAAGGTCCACCATG No data
Right 925604020 2:5639851-5639873 AGATAAGGACTTAATCTATCAGG No data
925604016_925604020 0 Left 925604016 2:5639828-5639850 CCAGAACAGAAGGTCCACCATGA No data
Right 925604020 2:5639851-5639873 AGATAAGGACTTAATCTATCAGG No data
925604012_925604020 28 Left 925604012 2:5639800-5639822 CCAGAAACCACAAGGTGAATAAT No data
Right 925604020 2:5639851-5639873 AGATAAGGACTTAATCTATCAGG No data
925604013_925604020 21 Left 925604013 2:5639807-5639829 CCACAAGGTGAATAATAGCACCC No data
Right 925604020 2:5639851-5639873 AGATAAGGACTTAATCTATCAGG No data
925604011_925604020 29 Left 925604011 2:5639799-5639821 CCCAGAAACCACAAGGTGAATAA No data
Right 925604020 2:5639851-5639873 AGATAAGGACTTAATCTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925604020 Original CRISPR AGATAAGGACTTAATCTATC AGG Intergenic
No off target data available for this crispr