ID: 925604021

View in Genome Browser
Species Human (GRCh38)
Location 2:5639855-5639877
Sequence AAGGACTTAATCTATCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925604015_925604021 5 Left 925604015 2:5639827-5639849 CCCAGAACAGAAGGTCCACCATG No data
Right 925604021 2:5639855-5639877 AAGGACTTAATCTATCAGGAAGG No data
925604018_925604021 -10 Left 925604018 2:5639842-5639864 CCACCATGAAGATAAGGACTTAA No data
Right 925604021 2:5639855-5639877 AAGGACTTAATCTATCAGGAAGG No data
925604013_925604021 25 Left 925604013 2:5639807-5639829 CCACAAGGTGAATAATAGCACCC No data
Right 925604021 2:5639855-5639877 AAGGACTTAATCTATCAGGAAGG No data
925604016_925604021 4 Left 925604016 2:5639828-5639850 CCAGAACAGAAGGTCCACCATGA No data
Right 925604021 2:5639855-5639877 AAGGACTTAATCTATCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925604021 Original CRISPR AAGGACTTAATCTATCAGGA AGG Intergenic
No off target data available for this crispr