ID: 925609560

View in Genome Browser
Species Human (GRCh38)
Location 2:5692215-5692237
Sequence TGCTTTGCAAAGATGGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 290}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925609560_925609581 23 Left 925609560 2:5692215-5692237 CCCACCCCCATCTTTGCAAAGCA 0: 1
1: 0
2: 0
3: 22
4: 290
Right 925609581 2:5692261-5692283 CGGGGCCTCCGAGTTAATAAAGG 0: 1
1: 0
2: 0
3: 1
4: 18
925609560_925609570 -9 Left 925609560 2:5692215-5692237 CCCACCCCCATCTTTGCAAAGCA 0: 1
1: 0
2: 0
3: 22
4: 290
Right 925609570 2:5692229-5692251 TGCAAAGCAGCCCGGAGGGCGGG 0: 1
1: 0
2: 1
3: 23
4: 233
925609560_925609575 0 Left 925609560 2:5692215-5692237 CCCACCCCCATCTTTGCAAAGCA 0: 1
1: 0
2: 0
3: 22
4: 290
Right 925609575 2:5692238-5692260 GCCCGGAGGGCGGGGTGGAGGGG 0: 1
1: 1
2: 4
3: 62
4: 643
925609560_925609572 -5 Left 925609560 2:5692215-5692237 CCCACCCCCATCTTTGCAAAGCA 0: 1
1: 0
2: 0
3: 22
4: 290
Right 925609572 2:5692233-5692255 AAGCAGCCCGGAGGGCGGGGTGG 0: 1
1: 0
2: 1
3: 21
4: 334
925609560_925609569 -10 Left 925609560 2:5692215-5692237 CCCACCCCCATCTTTGCAAAGCA 0: 1
1: 0
2: 0
3: 22
4: 290
Right 925609569 2:5692228-5692250 TTGCAAAGCAGCCCGGAGGGCGG 0: 1
1: 0
2: 0
3: 21
4: 426
925609560_925609573 -2 Left 925609560 2:5692215-5692237 CCCACCCCCATCTTTGCAAAGCA 0: 1
1: 0
2: 0
3: 22
4: 290
Right 925609573 2:5692236-5692258 CAGCCCGGAGGGCGGGGTGGAGG 0: 1
1: 0
2: 7
3: 70
4: 617
925609560_925609574 -1 Left 925609560 2:5692215-5692237 CCCACCCCCATCTTTGCAAAGCA 0: 1
1: 0
2: 0
3: 22
4: 290
Right 925609574 2:5692237-5692259 AGCCCGGAGGGCGGGGTGGAGGG 0: 1
1: 0
2: 6
3: 44
4: 412
925609560_925609583 30 Left 925609560 2:5692215-5692237 CCCACCCCCATCTTTGCAAAGCA 0: 1
1: 0
2: 0
3: 22
4: 290
Right 925609583 2:5692268-5692290 TCCGAGTTAATAAAGGAAGATGG 0: 1
1: 0
2: 0
3: 9
4: 172
925609560_925609578 3 Left 925609560 2:5692215-5692237 CCCACCCCCATCTTTGCAAAGCA 0: 1
1: 0
2: 0
3: 22
4: 290
Right 925609578 2:5692241-5692263 CGGAGGGCGGGGTGGAGGGGCGG 0: 1
1: 0
2: 24
3: 285
4: 2784
925609560_925609579 4 Left 925609560 2:5692215-5692237 CCCACCCCCATCTTTGCAAAGCA 0: 1
1: 0
2: 0
3: 22
4: 290
Right 925609579 2:5692242-5692264 GGAGGGCGGGGTGGAGGGGCGGG 0: 1
1: 3
2: 28
3: 384
4: 3813
925609560_925609571 -8 Left 925609560 2:5692215-5692237 CCCACCCCCATCTTTGCAAAGCA 0: 1
1: 0
2: 0
3: 22
4: 290
Right 925609571 2:5692230-5692252 GCAAAGCAGCCCGGAGGGCGGGG 0: 1
1: 0
2: 1
3: 15
4: 180
925609560_925609580 5 Left 925609560 2:5692215-5692237 CCCACCCCCATCTTTGCAAAGCA 0: 1
1: 0
2: 0
3: 22
4: 290
Right 925609580 2:5692243-5692265 GAGGGCGGGGTGGAGGGGCGGGG 0: 1
1: 2
2: 25
3: 278
4: 2585

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925609560 Original CRISPR TGCTTTGCAAAGATGGGGGT GGG (reversed) Intergenic
901287365 1:8091549-8091571 TTTTTTGCAGAGATGGGGTTTGG + Intergenic
902536908 1:17124445-17124467 GGCTTTCCATGGATGGGGGTGGG + Intergenic
904928894 1:34070692-34070714 TGGTCTGCAAGGGTGGGGGTGGG - Intronic
905533288 1:38699347-38699369 TGGTTAGCAAAGATGGGGCTGGG - Intergenic
906113512 1:43339884-43339906 TGCTGTGCAAATATAAGGGTTGG + Intronic
906418574 1:45642900-45642922 TGCATTTCTAAGATGGGTGTAGG + Intronic
906786469 1:48620184-48620206 GACTTTGCAAAGATGGGGATGGG + Intronic
907246160 1:53110391-53110413 TGTTCTGCAAAGCTGGGTGTTGG - Intronic
907931326 1:59003494-59003516 TGCTTTGCAAACAAGGAGGTCGG - Intergenic
908510560 1:64847281-64847303 TCCTTAGGAAAGGTGGGGGTTGG + Intronic
908538347 1:65099668-65099690 TGTTTTGTAGAGATGGGGTTTGG - Intergenic
908884557 1:68773450-68773472 TGCTGGGCAAAGATTGGAGTGGG - Intergenic
909018478 1:70405160-70405182 TTCTTTGCAGAGATGGGTGGAGG - Intergenic
909120071 1:71591860-71591882 TGTTTTGCAGAAATGGGGATGGG - Intronic
909629241 1:77753414-77753436 TTTTTTGTAAAGATGGGGGGTGG - Intronic
909643496 1:77891903-77891925 TTTTTTGTAGAGATGGGGGTGGG - Intronic
910851126 1:91650784-91650806 TGCATTCCAAAGATGGGCTTTGG + Intergenic
911606695 1:99914110-99914132 TTCTTTTCAAATATGGTGGTGGG - Intronic
912104136 1:106249333-106249355 TGCTTTGTAAAGTTGGTGTTGGG - Intergenic
915423730 1:155806459-155806481 TTTTTTGTAGAGATGGGGGTGGG + Intronic
919428744 1:197467118-197467140 AGATCTGCAAATATGGGGGTTGG + Intronic
920839900 1:209545467-209545489 TGCCTTGCCATGATGGGGGAAGG - Intergenic
921339235 1:214117943-214117965 TGCTTTGCAAAAATGGATCTGGG + Intergenic
922655421 1:227378321-227378343 AGCTTTGCCAAGAGGGTGGTTGG + Intergenic
924062507 1:240189607-240189629 TGCTTTTCAAAAATGCGGCTAGG + Intronic
1063671380 10:8102670-8102692 TTTTTTGTAAAGATTGGGGTGGG - Intergenic
1065768051 10:29050315-29050337 TTCTTTACAAAGATGGGGGCAGG - Intergenic
1065798494 10:29329296-29329318 GGCTTTGCAAAAATGGGAGGAGG - Intergenic
1067363965 10:45607999-45608021 TTCTTTGCAGACTTGGGGGTTGG - Intergenic
1070085420 10:73232396-73232418 TTCTTTGGAAAGCTGGGAGTGGG - Intronic
1070694593 10:78552471-78552493 TGCTCTGCAGGGGTGGGGGTGGG + Intergenic
1070795242 10:79212478-79212500 TTTTTTGCACAGATGGGGCTGGG + Intronic
1071388477 10:85145993-85146015 TGCTGTGAAAAGATAGAGGTGGG + Intergenic
1071574748 10:86716848-86716870 TGGTTGGGAGAGATGGGGGTAGG + Intronic
1071703666 10:87972489-87972511 TGCTTTGGAAAGATCAGGGAAGG + Intergenic
1071755354 10:88531990-88532012 TGCTAAGTAGAGATGGGGGTTGG - Intronic
1071984184 10:91034284-91034306 TGCTTTGTCAAGGTGGGGGCAGG + Intergenic
1073334878 10:102699135-102699157 TATTTTGCCAAGATGGGTGTGGG + Intronic
1074120940 10:110494204-110494226 TGCTTTACAAAGAATGGGGGCGG + Intergenic
1075211938 10:120498944-120498966 GGCTTTGCAGAGATGGGGAAAGG + Intronic
1075666233 10:124232992-124233014 TTCTGTGTAAAGATGGGGATAGG - Intergenic
1076825254 10:132963948-132963970 AGGCTTGCAAAGATGGAGGTGGG - Intergenic
1078226809 11:9399620-9399642 TGCTTTGTAAAGATAGTGATTGG + Intronic
1079743608 11:24096765-24096787 TGCTCGGCAAAGATGAGGATTGG + Intergenic
1079757598 11:24284251-24284273 TCCTTTGCTAACATTGGGGTTGG - Intergenic
1080757286 11:35214021-35214043 TGCTTTTGAAAAATGTGGGTGGG + Intronic
1081535365 11:43992345-43992367 TGCCTTGAAAAGATGGGGGAGGG - Intergenic
1081582704 11:44363419-44363441 TAATTTGGGAAGATGGGGGTGGG - Intergenic
1083141568 11:60726187-60726209 TACTTTGCAAAGAGGCGGGTCGG + Intergenic
1083485220 11:62979352-62979374 TGCCTTGCAATGATGAGTGTTGG + Intronic
1083743982 11:64725134-64725156 TGATGGGCAAAGCTGGGGGTAGG - Intergenic
1084001569 11:66297978-66298000 TTTTTTGTAAAGACGGGGGTGGG - Intergenic
1084676278 11:70637393-70637415 TGCTATTCACAGATGGGGGCAGG + Intronic
1086125627 11:83345648-83345670 GGGTTTGCAAAGATGAGGGCAGG + Intergenic
1086193304 11:84106680-84106702 TGCTTTAACAAGATGGGGGATGG + Intronic
1089180916 11:116582284-116582306 AGCTCTGCAAAGCAGGGGGTTGG + Intergenic
1090880813 11:130830274-130830296 TGCTTTGAAGAGAGAGGGGTTGG - Intergenic
1093955022 12:25207050-25207072 AGTTTTGCAAAGAAGGGGTTTGG - Intronic
1094526601 12:31235258-31235280 CGCCTTCCAAAGCTGGGGGTGGG - Intergenic
1095491051 12:42734219-42734241 ATCTTTCCATAGATGGGGGTGGG + Intergenic
1096743826 12:53712888-53712910 TGCATTGATAAGATAGGGGTAGG + Intronic
1097020589 12:56017929-56017951 TGCTTTGGAAAGAAGGTGGGAGG - Intronic
1097942930 12:65332070-65332092 TGCTCTGCTAAAATGGGGCTGGG - Intronic
1098775839 12:74614812-74614834 TGCTTTGCAAACATGTGCATTGG - Intergenic
1100770248 12:97913616-97913638 TGCTCTGGAAAGATGGGAGATGG - Intergenic
1100820904 12:98428779-98428801 TGATTTGCCAAGTTGGGGGAAGG + Intergenic
1101669227 12:106851577-106851599 TCCTTTGCAAAGAGAGAGGTAGG + Exonic
1104430072 12:128709048-128709070 TAGTTTGCAAAGCTGGGGCTCGG - Intergenic
1105986586 13:25573214-25573236 TGCATTGCAAAAATGGAGGTTGG + Intronic
1106587080 13:31066864-31066886 TGATTTTCAAAGACGGGGGTCGG + Intergenic
1107811636 13:44206354-44206376 TGCTTTGGACAGATGGTGGGTGG + Intergenic
1107904269 13:45047724-45047746 TGTTGTCCAGAGATGGGGGTGGG - Intergenic
1108124855 13:47231481-47231503 TGATTTGCAGAGATGGAAGTAGG - Intergenic
1110105144 13:71664576-71664598 TGCTTTAAAATGATGGGAGTTGG + Intronic
1111744273 13:92246500-92246522 TGGTTTGTAAAGATGGGGTGTGG - Intronic
1112099549 13:96172258-96172280 TGCCTTGCAAAGCTGGGTTTTGG - Intronic
1112163750 13:96895870-96895892 AGCTTTGCAAAGATGGTTGATGG + Intergenic
1115700898 14:35951957-35951979 TTCTTTGGAAAGGAGGGGGTAGG + Intergenic
1116369948 14:44117629-44117651 TGATTTGCAATGCTGGTGGTGGG - Intergenic
1118278806 14:64410394-64410416 TTTTTTGTAAAGATGGGGGGGGG + Intronic
1118285960 14:64472995-64473017 AATTTTGCAAAGCTGGGGGTTGG + Exonic
1119668199 14:76499427-76499449 TGCTTGGCAAAGATGAGTCTGGG - Intronic
1120857921 14:89228949-89228971 TGCTTTGGAAAGAGGCGGGAGGG - Intronic
1120898956 14:89559200-89559222 TTTTTTGCAGAGATGGGGTTGGG - Intronic
1121984846 14:98495113-98495135 TGCTTTCCAAAGGTGGGCATGGG + Intergenic
1124039280 15:26085006-26085028 GCCTTAGCAATGATGGGGGTGGG + Intergenic
1124348350 15:28937277-28937299 TGCTTTGCTCAGATGGTGCTGGG + Intronic
1124579441 15:30940337-30940359 TGCTGTCCAAAGTTGGGGGCTGG + Exonic
1124868151 15:33514334-33514356 TGCCTTGAAAAGATGGAGGGTGG + Intronic
1125134258 15:36323454-36323476 TCCTGTGCAATGATGGGAGTGGG + Intergenic
1125464591 15:39938234-39938256 TGCTTAGCAAATATGGGTGATGG + Intronic
1126463828 15:48942236-48942258 TGCTTTGGAAATAAAGGGGTTGG - Intronic
1127502694 15:59569551-59569573 TGCTTTTAAAAAATGGGGGGAGG - Intergenic
1127856635 15:62958897-62958919 TGCTATGCAAAAGTGGGGCTGGG - Intergenic
1128889243 15:71316298-71316320 TGTTTTGAAAAGATGGGTTTAGG - Intronic
1129188619 15:73925133-73925155 TGCCTGGCAAGGATGGGGTTGGG + Intergenic
1129600794 15:76996909-76996931 TGGTGTGCAAAGTTGGGGGAAGG + Intronic
1129643829 15:77411780-77411802 CTTTTTGTAAAGATGGGGGTTGG + Intronic
1129956146 15:79638434-79638456 TGCTTTGCAGGGGTGGGGGTTGG - Intergenic
1129970215 15:79771822-79771844 ATCTATGCAAAGAAGGGGGTGGG + Intergenic
1131061057 15:89404964-89404986 TGCTTTGCAAAGGGTGAGGTGGG + Intergenic
1131823019 15:96291997-96292019 TGCTTAGAAAAGATGAGAGTTGG + Intergenic
1132590541 16:724541-724563 TGGTTGGAAAAGATGGGGGGTGG - Intronic
1132833389 16:1940748-1940770 TGCTTTGCACAGCTGGGGCCAGG - Intronic
1134002638 16:10794675-10794697 CGCTTGGCTGAGATGGGGGTTGG + Intronic
1134286639 16:12867688-12867710 TTTTTTGCAGAGATGGGGGGGGG + Intergenic
1134419542 16:14072276-14072298 TGCTTTTCAAGGATGTGTGTAGG - Intronic
1135131699 16:19858923-19858945 TGCTTTGCAAGGATGGGGTGGGG + Exonic
1135868270 16:26125268-26125290 TTTTTTCCACAGATGGGGGTGGG + Intronic
1138070966 16:53992634-53992656 TGCTGGGCAAAGAGGAGGGTAGG - Intronic
1140191875 16:72824552-72824574 TGCTTTTGAAAAATGCGGGTTGG - Intronic
1141146717 16:81536083-81536105 TGCTCTGCAAAGCCAGGGGTCGG - Intronic
1141410224 16:83828153-83828175 TGCACTGCAAAGCTGGGGGTGGG - Intergenic
1141894720 16:86951999-86952021 TCCTTTGTAGAGATGGGGGAGGG - Intergenic
1143355894 17:6328232-6328254 TCTTATGCAAAGATGGGTGTGGG + Intergenic
1143886654 17:10070058-10070080 TGCTGTGCCAAGATGGGTTTAGG - Intronic
1143917817 17:10306902-10306924 TCCTTTTCAGAGATGGGGTTTGG - Intronic
1144285146 17:13766957-13766979 AGCTTTGTAAAGAAGGTGGTTGG + Intergenic
1144290983 17:13825936-13825958 TGCTTTGATAAGATAGGGGAGGG + Intergenic
1146945942 17:36873569-36873591 TTCTTTTTAAAGGTGGGGGTGGG - Intergenic
1147639381 17:41985670-41985692 TGTGTAGCAAAGATGTGGGTGGG + Intronic
1147832593 17:43307300-43307322 TTTTTTGTAGAGATGGGGGTTGG - Intergenic
1148194711 17:45705071-45705093 TGCTTGGTAAATATTGGGGTGGG + Intergenic
1148779465 17:50113238-50113260 TGGTTGGGAAAGATGAGGGTTGG + Intronic
1149415523 17:56455950-56455972 TGGTTTACAAAAATGGGTGTAGG - Intronic
1149524971 17:57348414-57348436 TGATTTGCAATGTTGGAGGTAGG + Intronic
1149775551 17:59354127-59354149 TGCTTTCTAAAGTTGGGGCTGGG + Intronic
1151916872 17:77124685-77124707 AGCATTGCAAAGTTGAGGGTTGG + Intronic
1152721028 17:81923893-81923915 AACTTTGAAAAGCTGGGGGTGGG + Intronic
1153129120 18:1834497-1834519 TGCTATGGGAAGATGGGGGGAGG - Intergenic
1153134892 18:1905565-1905587 TGATTTTCAAGGATGGGGGAAGG - Intergenic
1153585340 18:6615025-6615047 TGCTTTGCGGGGTTGGGGGTGGG - Intergenic
1153642794 18:7170505-7170527 TGCTGTGCTAAGACGGGGCTGGG + Intergenic
1154384158 18:13878680-13878702 TTTTTTGTAAAGATGGGGGGCGG + Intergenic
1154408116 18:14115297-14115319 GGCTATCCAAAGATGGGGTTTGG + Intronic
1157378960 18:47193427-47193449 TGGGTGGCAAAGATGGGGGAAGG - Intergenic
1157562623 18:48659518-48659540 AGCTGTGCAAAGATGGGGTCCGG + Intronic
1158327817 18:56329362-56329384 TTCTTTGCAAAGATGAACGTGGG - Intergenic
1158609619 18:58927308-58927330 TACTTTGCACAGGTTGGGGTGGG + Intronic
1160174837 18:76584677-76584699 TTCTTGGCAGAGCTGGGGGTGGG - Intergenic
1161074820 19:2280519-2280541 TGTTTTGTAGAGATGGGGGGCGG + Intronic
1161261402 19:3339839-3339861 GGCTTTTCAAAGCTGTGGGTAGG + Intergenic
1161565248 19:4998207-4998229 TGCCTGGCAAAGATGTAGGTGGG + Intronic
1161842732 19:6692799-6692821 CCCTTTGCAAAGATTGGGCTGGG - Intronic
1162393993 19:10405469-10405491 GGGTTTGCACCGATGGGGGTGGG - Intronic
1162466031 19:10841303-10841325 TATTTTGTAAAGATGGTGGTAGG - Intronic
1162827591 19:13263146-13263168 AGCTGTGCAGAAATGGGGGTGGG - Intronic
1162913021 19:13860030-13860052 TTTTTTGGAGAGATGGGGGTGGG - Intergenic
1164403113 19:27916475-27916497 TCTTTTGCAAAGATGGGGATTGG + Intergenic
1164403540 19:27920903-27920925 TGCATTGCAAAAATGGAGGTTGG + Intergenic
1164834368 19:31348524-31348546 TGCTATGCGGAGATGAGGGTGGG + Intronic
1164941692 19:32255998-32256020 TTTTTTGTAAAGATGGGGTTGGG - Intergenic
1165023676 19:32943925-32943947 TGCTTTGAAAAGATGGCTCTGGG + Intronic
1165035958 19:33034003-33034025 TGTTTTGCCAAGATGGGAGGGGG - Intronic
1165470937 19:36004186-36004208 TGATTTGTAGAGATGGGGGGAGG + Intronic
1166531249 19:43544822-43544844 TGTTTTGTAAAGGCGGGGGTCGG + Intronic
1167514390 19:49914621-49914643 TGGTTCTCACAGATGGGGGTGGG - Intronic
1167585191 19:50370648-50370670 TTTTTTGTAGAGATGGGGGTGGG + Intronic
1167963320 19:53124526-53124548 TGATTTCCAAAGTTGGAGGTAGG - Intronic
1168487602 19:56777798-56777820 TGAGATGCAAAGATGGGGGGAGG - Intronic
925609560 2:5692215-5692237 TGCTTTGCAAAGATGGGGGTGGG - Intergenic
926767046 2:16330755-16330777 TGGGATGCAGAGATGGGGGTGGG - Intergenic
927516620 2:23675332-23675354 GGCATTGCAGAGGTGGGGGTGGG - Intronic
927848525 2:26484630-26484652 TGCTCTGCAATGATGAGGGGTGG + Exonic
929494051 2:42424051-42424073 GGATTTGCAAAGCTGGAGGTGGG - Intronic
929993777 2:46812178-46812200 TCCTTTCCAAAGCTGGGGGCAGG + Intergenic
931253017 2:60550402-60550424 AGCTTTGCGAGGGTGGGGGTGGG - Intronic
931421753 2:62134586-62134608 TTTTTTGTAGAGATGGGGGTAGG - Intronic
931617458 2:64174605-64174627 TGCTTTCCCAAGATGGGGTTGGG - Intergenic
931673744 2:64672772-64672794 AGCATGGCAAGGATGGGGGTAGG - Intronic
933331105 2:80894333-80894355 TGCTTGGCAAAAATGAGAGTTGG + Intergenic
933900459 2:86846115-86846137 TGCTGTGCAGAGCTTGGGGTGGG + Intronic
933978867 2:87534325-87534347 TGTTTTGAAAAGGCGGGGGTTGG + Intergenic
934732025 2:96665462-96665484 AGCTTGGCAAGGATGGGGGATGG - Intergenic
935403644 2:102685718-102685740 TGCATGGCAGAGGTGGGGGTGGG + Intronic
935780087 2:106503110-106503132 TGCTGTGCAGAGCTTGGGGTGGG - Intergenic
936249801 2:110859678-110859700 TGCTCTGCAAACAAGAGGGTTGG + Intronic
936314962 2:111416474-111416496 TGTTTTGAAAAGGCGGGGGTTGG - Intergenic
939427578 2:142059128-142059150 TGCTTGCCTAAGATTGGGGTGGG + Intronic
940113730 2:150184352-150184374 TGTGTTGGAGAGATGGGGGTGGG - Intergenic
940943575 2:159590728-159590750 CTAATTGCAAAGATGGGGGTGGG + Intronic
942613140 2:177762662-177762684 TGCTGTGCTAACATGGGGGAGGG + Intronic
942848511 2:180454995-180455017 TGATTCCCAAAGATGGGGATGGG + Intergenic
945438234 2:209844769-209844791 TTTTTTGTAGAGATGGGGGTGGG + Intronic
946241663 2:218359677-218359699 TGGTTTTAAAAGATGGGGGTGGG - Intronic
946816149 2:223580418-223580440 TGCTTTGGAAAGATGATGGCAGG - Intergenic
947614658 2:231547894-231547916 TGACTTGCAAAAATGTGGGTGGG + Intergenic
947885278 2:233564450-233564472 TGGTTTGCAGAGATGGGGTATGG + Intronic
1168848312 20:959897-959919 TTCTCTGCAAAGATGGGGTCAGG + Exonic
1169926282 20:10787891-10787913 TGTTTTGCAAAGACTTGGGTAGG + Intergenic
1170088662 20:12566210-12566232 TCATTTGCAAATATTGGGGTGGG + Intergenic
1170465116 20:16615717-16615739 TACTTTCCAAAGATGGGGAAGGG + Intergenic
1170888591 20:20361075-20361097 TGCTTTGCATTGAGGGGGGCGGG + Intergenic
1171971708 20:31569021-31569043 CGCTTTCCTAGGATGGGGGTGGG + Intronic
1172367679 20:34362588-34362610 TTCTTTGTAGAGATGGGGATGGG - Intergenic
1178415932 21:32405116-32405138 ATTTTTCCAAAGATGGGGGTTGG + Intergenic
1181043539 22:20204085-20204107 GGGTTTGCAAGGATAGGGGTGGG + Intergenic
1182793523 22:32973213-32973235 TGCTTTTCACAGAGGGTGGTTGG - Intronic
1183467382 22:37986525-37986547 AGCTGTGCCAGGATGGGGGTGGG + Intronic
1183991157 22:41597837-41597859 TGGTTTATAAAGATGGGGGAAGG - Intergenic
1185285519 22:49998105-49998127 TGCTCAGCAGGGATGGGGGTGGG - Intronic
950112902 3:10431830-10431852 TGCTTTTCCAAAAAGGGGGTGGG + Intronic
950633913 3:14302111-14302133 TGATTTGCAAAAATGGCCGTAGG + Intergenic
951950049 3:28190094-28190116 TGCTTTCCAGAGATGGGACTGGG - Intergenic
953315621 3:41923962-41923984 TCCTGTGTAAAGATAGGGGTTGG - Intronic
954735365 3:52703076-52703098 TGCTTTGGAAAGGTGTGTGTGGG - Intronic
955626019 3:60920240-60920262 TGCTTTGGGAAAATGGGGGAGGG + Intronic
960743164 3:120856864-120856886 TGTTTTTCAAAAATGGTGGTTGG + Intergenic
961828980 3:129613582-129613604 TGCTCTGCAGGGGTGGGGGTCGG - Intergenic
962985761 3:140534355-140534377 GGCCTTGCAGACATGGGGGTGGG - Intronic
963315395 3:143753386-143753408 TGCCTTGCAAAAATAGGGGATGG - Intronic
963380935 3:144529316-144529338 TGCTTTACAAAGATGGGCAAAGG + Intergenic
963690602 3:148496565-148496587 TGCTTTGCAAAGATTAGTCTAGG - Intergenic
964020187 3:152000705-152000727 TGTTTTATAAAGATGGGGATAGG + Intergenic
964020418 3:152003663-152003685 TGTTTTATAAAGATGGGGATAGG - Intergenic
964824326 3:160808822-160808844 TGCTCTACAAAGATGGGAGGAGG - Intronic
964945762 3:162221678-162221700 TATTTTACAAAGTTGGGGGTGGG - Intergenic
966890435 3:184403762-184403784 TTTTTTGTAAAGATGGGGGGGGG + Intronic
968259025 3:197304167-197304189 TGCTTCTCAAACATGGGGATGGG - Intergenic
968705029 4:2073728-2073750 TGCAATGCAAAGATGGCGGCAGG + Intronic
968810963 4:2799553-2799575 TCCTCTGCAGAGGTGGGGGTTGG - Intronic
969600173 4:8171468-8171490 TGCTTTCCAGAGAGGGGTGTGGG + Intergenic
969956766 4:10898540-10898562 TTCTTTACAAAGATGGTGTTAGG + Intergenic
970246135 4:14065876-14065898 AGCTGTGCAAAGCTCGGGGTGGG + Intergenic
971453097 4:26818404-26818426 TTTTTTGTAGAGATGGGGGTGGG + Intergenic
975738198 4:77402512-77402534 AACTTTGCAGAGATGGGGATAGG + Intronic
976088700 4:81432678-81432700 TTCTTTACAAAGAAAGGGGTGGG + Intronic
978673433 4:111279536-111279558 TTCTTTAAAAAGGTGGGGGTTGG - Intergenic
982752160 4:159175450-159175472 TGCTTTACAAAGATCTGGGGAGG + Intronic
982896920 4:160942005-160942027 AGTTTTCCACAGATGGGGGTGGG + Intergenic
983124330 4:163931688-163931710 TGCTTTCCTAATGTGGGGGTGGG + Intronic
983823772 4:172231013-172231035 TGCTTTAAAAAGCTGGGGGTGGG - Intronic
984703122 4:182831504-182831526 TGCTATGCATATATGGGGGCAGG + Intergenic
985132931 4:186757363-186757385 TGCTTTTCAAATTTTGGGGTAGG + Intergenic
988724066 5:33908274-33908296 TAGTTTGCAATGATGGAGGTGGG + Intergenic
993841207 5:92881207-92881229 TGGTTTTGAAGGATGGGGGTGGG - Intergenic
994591882 5:101783880-101783902 TGCTTTGGAGAGCTGGGAGTGGG + Intergenic
997304383 5:132827083-132827105 AGCAGGGCAAAGATGGGGGTCGG - Intronic
998154194 5:139775198-139775220 TGCCTTGCAAAGATAGGGTGTGG - Intergenic
1000245327 5:159444255-159444277 TTATTTGTAGAGATGGGGGTGGG - Intergenic
1000465474 5:161570223-161570245 AGCTCTGCAAAAATGGGGCTGGG + Intronic
1000621379 5:163489892-163489914 TGCCTTGCTAAGCTGGGAGTGGG + Intronic
1001313646 5:170628040-170628062 TGCTTTGCAGAGAAGTGAGTGGG + Intronic
1001644796 5:173272019-173272041 TTTTTTGTAGAGATGGGGGTGGG + Intergenic
1001692550 5:173643820-173643842 TGCTTTTCTCAGATGGGGGTAGG - Intergenic
1003530882 6:6936511-6936533 CTCTTTACAAAGATGGGGGCAGG - Intergenic
1003620624 6:7696221-7696243 TGTTTTGGAAACATGTGGGTTGG + Intergenic
1005308317 6:24534711-24534733 GGCTTTGCCAAGATGGGAGGAGG + Intronic
1005459815 6:26057126-26057148 CTCTTTTCATAGATGGGGGTGGG + Intergenic
1005590336 6:27318262-27318284 TGCTTTGTGAAGCTGGGGCTGGG - Intergenic
1005710473 6:28499450-28499472 TGCTTTGCAAATCTGGGAATAGG + Intergenic
1005726645 6:28655670-28655692 TGCTTTGCAAAGCTAGGTATTGG + Intergenic
1006432749 6:34007846-34007868 TGCCTGGCAGAGCTGGGGGTAGG + Intergenic
1008167906 6:48163368-48163390 TTCTTTGCAAAGAGGGTGGAAGG - Intergenic
1008754184 6:54773879-54773901 AGTTTTGCAAAGAAGGGGTTTGG + Intergenic
1011859437 6:91736891-91736913 TGATTTGCAAAGGTATGGGTGGG + Intergenic
1011997067 6:93604451-93604473 TGCTCTGTAAAAATGGGAGTGGG + Intergenic
1015880370 6:137866033-137866055 GGACTTGCAGAGATGGGGGTGGG - Intergenic
1016049238 6:139513226-139513248 GGCTTGGCAAAGCAGGGGGTGGG + Intergenic
1016307443 6:142698566-142698588 TGCTTTCCAAGGATGGGGTAAGG - Intergenic
1016881803 6:148918999-148919021 AGCCATGCAAAGATGGTGGTGGG - Intronic
1018464955 6:164035477-164035499 TTTTTTGCAGAGATGGGGGAGGG + Intergenic
1018981648 6:168606265-168606287 TTCTTTGAAAATGTGGGGGTGGG - Intronic
1021044908 7:15910322-15910344 TGCTTTGGAAGCAAGGGGGTGGG + Intergenic
1021546219 7:21815878-21815900 TGCGTTGCAAAGTAAGGGGTTGG - Intronic
1023690694 7:42783381-42783403 TGATTTGAGAAGATGGAGGTGGG + Intergenic
1027993807 7:85397701-85397723 AACTTTCCAAAGTTGGGGGTGGG - Intergenic
1028914117 7:96240084-96240106 TCCCTTGCAAAGCTGGGGGGAGG - Intronic
1029054183 7:97723249-97723271 TACTTTGCAGATATGGGGGGGGG - Intergenic
1029140085 7:98403009-98403031 TTTTTTGCAGAGATGGGGGTGGG - Intergenic
1029731222 7:102439437-102439459 TGCTTAGCAAGGAGGGAGGTTGG + Intronic
1030327771 7:108239509-108239531 TGGTCTGCAAAGATGAGGGGAGG - Intronic
1030600747 7:111589023-111589045 GACTTTGGAAGGATGGGGGTGGG + Intergenic
1030947844 7:115748097-115748119 TGCTTTAAAAAGGTCGGGGTGGG - Intergenic
1032610708 7:133409395-133409417 TGCTTTGAGAAGATGGAGGGTGG - Intronic
1035859392 8:3011312-3011334 GGTATGGCAAAGATGGGGGTGGG + Intronic
1037441914 8:18925207-18925229 TGTTTTGTAGAGATGGGGTTTGG - Intronic
1038520788 8:28230404-28230426 TGCTGTGACAAAATGGGGGTAGG + Intergenic
1039085013 8:33771317-33771339 TGTTTTTCAAAGATGGGAGGAGG + Intergenic
1041877307 8:62704785-62704807 TTCTTGGCCAAGATGGTGGTTGG - Intronic
1042606130 8:70548480-70548502 GGCTAAGCAAAGATCGGGGTGGG + Intergenic
1042944964 8:74145301-74145323 GGCTTTGCAAAAATGGGCCTGGG - Intergenic
1044299137 8:90563633-90563655 TGCTTTGAAATGAGGGGGGCAGG + Intergenic
1046049233 8:109001529-109001551 TGCTGTTGGAAGATGGGGGTAGG - Intergenic
1047219969 8:122911265-122911287 GGCTTTGCCAAGATGAGGGTGGG + Intronic
1047750708 8:127878379-127878401 TGCCTTGCAGAGTTGGGGGAAGG - Intergenic
1047793820 8:128233517-128233539 TGCTAGGTAAAGATGGGGGTGGG - Intergenic
1048214467 8:132481611-132481633 TGCTATTCAAAGATTGGGGGAGG - Intergenic
1049766281 8:144356710-144356732 TGCCCTGCAGAGATGGGGGGAGG + Exonic
1052342899 9:27380682-27380704 TGATTTACAAGGGTGGGGGTGGG - Intronic
1053426559 9:38014071-38014093 CGCTTTGCAAACTTTGGGGTGGG - Intronic
1056538266 9:87550185-87550207 TCCTTTGGAGGGATGGGGGTGGG - Intronic
1057666253 9:97047749-97047771 TGCTGTGCAGAGGTGTGGGTGGG - Intergenic
1060833284 9:126733556-126733578 TGCTCTGGAAAGATGTGGGAAGG + Intergenic
1060872591 9:127054730-127054752 TACTTTGGGAAGCTGGGGGTGGG + Intronic
1062399317 9:136365544-136365566 TGCTTTGGAGTGATGGGGGACGG - Intronic
1185645731 X:1614382-1614404 TTCTTTGTAGAGATCGGGGTGGG - Intergenic
1186151141 X:6675965-6675987 TGTTTTGTAGAGATGGGGGCAGG - Intergenic
1186788746 X:12976373-12976395 GCCTTTCTAAAGATGGGGGTGGG - Intronic
1188461085 X:30428105-30428127 TCCTTTGGAAAAATGGGGATAGG - Intergenic
1189417893 X:40831328-40831350 GGCTCTGCAATGATGGGGATGGG + Intergenic
1189989217 X:46578581-46578603 TTTTTTGCAAAGATTGGGGATGG + Intronic
1190459429 X:50657618-50657640 TGGGTTGCGAAGGTGGGGGTAGG + Intronic
1192117722 X:68427493-68427515 GGCTTTACAAAGATGGGGCTGGG - Intronic
1194417788 X:93635213-93635235 TGTTTTCTAAAGATGGGGATGGG + Intergenic
1194728122 X:97423016-97423038 TGCTTTCCAACTCTGGGGGTTGG - Intronic
1194890281 X:99370838-99370860 TGATTTCCAATGATGGTGGTGGG + Intergenic
1195303219 X:103552886-103552908 TGCTTTACAAAGAGGGGTTTGGG - Intergenic
1196117811 X:112016129-112016151 TTCTCTACAAAGATGGGGGTGGG + Intronic
1196548794 X:116996813-116996835 TGATTTGCAAAGATATGGTTTGG - Intergenic
1197944631 X:131825972-131825994 TCTTTTGCAAGGATGGCGGTGGG - Intergenic
1198100610 X:133418856-133418878 TGATTTCCAAATATGGGGCTGGG + Intergenic
1199850715 X:151723368-151723390 AACTTTGCAAAGCTGGGGCTGGG - Intergenic