ID: 925609636

View in Genome Browser
Species Human (GRCh38)
Location 2:5692514-5692536
Sequence GACGACGGCCGCCGGCGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 183}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925609636_925609652 24 Left 925609636 2:5692514-5692536 CCACCGCGCCGGCGGCCGTCGTC 0: 1
1: 0
2: 0
3: 18
4: 183
Right 925609652 2:5692561-5692583 TGCAGCCTGGAAGGGGGGGCGGG 0: 1
1: 0
2: 4
3: 68
4: 591
925609636_925609643 11 Left 925609636 2:5692514-5692536 CCACCGCGCCGGCGGCCGTCGTC 0: 1
1: 0
2: 0
3: 18
4: 183
Right 925609643 2:5692548-5692570 CACAGCCGCTGTGTGCAGCCTGG 0: 1
1: 0
2: 2
3: 24
4: 249
925609636_925609656 28 Left 925609636 2:5692514-5692536 CCACCGCGCCGGCGGCCGTCGTC 0: 1
1: 0
2: 0
3: 18
4: 183
Right 925609656 2:5692565-5692587 GCCTGGAAGGGGGGGCGGGGGGG 0: 1
1: 0
2: 10
3: 137
4: 1347
925609636_925609649 19 Left 925609636 2:5692514-5692536 CCACCGCGCCGGCGGCCGTCGTC 0: 1
1: 0
2: 0
3: 18
4: 183
Right 925609649 2:5692556-5692578 CTGTGTGCAGCCTGGAAGGGGGG 0: 1
1: 0
2: 5
3: 41
4: 370
925609636_925609646 16 Left 925609636 2:5692514-5692536 CCACCGCGCCGGCGGCCGTCGTC 0: 1
1: 0
2: 0
3: 18
4: 183
Right 925609646 2:5692553-5692575 CCGCTGTGTGCAGCCTGGAAGGG 0: 1
1: 0
2: 3
3: 17
4: 192
925609636_925609655 27 Left 925609636 2:5692514-5692536 CCACCGCGCCGGCGGCCGTCGTC 0: 1
1: 0
2: 0
3: 18
4: 183
Right 925609655 2:5692564-5692586 AGCCTGGAAGGGGGGGCGGGGGG 0: 1
1: 0
2: 4
3: 90
4: 917
925609636_925609651 23 Left 925609636 2:5692514-5692536 CCACCGCGCCGGCGGCCGTCGTC 0: 1
1: 0
2: 0
3: 18
4: 183
Right 925609651 2:5692560-5692582 GTGCAGCCTGGAAGGGGGGGCGG 0: 1
1: 0
2: 3
3: 67
4: 837
925609636_925609653 25 Left 925609636 2:5692514-5692536 CCACCGCGCCGGCGGCCGTCGTC 0: 1
1: 0
2: 0
3: 18
4: 183
Right 925609653 2:5692562-5692584 GCAGCCTGGAAGGGGGGGCGGGG 0: 1
1: 0
2: 4
3: 60
4: 601
925609636_925609647 17 Left 925609636 2:5692514-5692536 CCACCGCGCCGGCGGCCGTCGTC 0: 1
1: 0
2: 0
3: 18
4: 183
Right 925609647 2:5692554-5692576 CGCTGTGTGCAGCCTGGAAGGGG 0: 1
1: 0
2: 3
3: 44
4: 267
925609636_925609644 15 Left 925609636 2:5692514-5692536 CCACCGCGCCGGCGGCCGTCGTC 0: 1
1: 0
2: 0
3: 18
4: 183
Right 925609644 2:5692552-5692574 GCCGCTGTGTGCAGCCTGGAAGG 0: 1
1: 0
2: 1
3: 28
4: 260
925609636_925609648 18 Left 925609636 2:5692514-5692536 CCACCGCGCCGGCGGCCGTCGTC 0: 1
1: 0
2: 0
3: 18
4: 183
Right 925609648 2:5692555-5692577 GCTGTGTGCAGCCTGGAAGGGGG 0: 1
1: 0
2: 8
3: 56
4: 422
925609636_925609650 20 Left 925609636 2:5692514-5692536 CCACCGCGCCGGCGGCCGTCGTC 0: 1
1: 0
2: 0
3: 18
4: 183
Right 925609650 2:5692557-5692579 TGTGTGCAGCCTGGAAGGGGGGG 0: 1
1: 0
2: 2
3: 30
4: 434
925609636_925609654 26 Left 925609636 2:5692514-5692536 CCACCGCGCCGGCGGCCGTCGTC 0: 1
1: 0
2: 0
3: 18
4: 183
Right 925609654 2:5692563-5692585 CAGCCTGGAAGGGGGGGCGGGGG 0: 1
1: 0
2: 2
3: 69
4: 677

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925609636 Original CRISPR GACGACGGCCGCCGGCGCGG TGG (reversed) Intergenic
900269148 1:1778350-1778372 GACGGCTGGCGGCGGCGCGGCGG - Intronic
903526511 1:23995016-23995038 GGCGGCGCTCGCCGGCGCGGCGG + Intergenic
903907518 1:26696888-26696910 GAAGACGGCGGCCGCGGCGGCGG - Exonic
904794809 1:33051266-33051288 GGCGGCGCTCGCCGGCGCGGCGG - Intronic
905449223 1:38046412-38046434 GACGACGGCGGCGGCGGCGGAGG - Exonic
906436913 1:45803992-45804014 GGCGGCGCTCGCCGGCGCGGCGG - Exonic
906486639 1:46240427-46240449 GGCGGCGCTCGCCGGCGCGGCGG - Intergenic
906532775 1:46533051-46533073 GCAGACGGCCGCGGGCGCCGGGG + Intergenic
906615764 1:47231974-47231996 GGCGGCGGCAGCCGGGGCGGGGG + Intronic
907126626 1:52056284-52056306 GACGACGGCGGCGGCGGCGGCGG - Exonic
908272943 1:62437620-62437642 GGCGAGGGCGCCCGGCGCGGGGG + Intronic
908355781 1:63323841-63323863 GGCGGCGGCGGCCGGCGCCGCGG + Exonic
911440566 1:97921031-97921053 GACTAGGGCCGGCGGCGCGGGGG + Intronic
912825495 1:112899366-112899388 GGCGGCGCTCGCCGGCGCGGCGG + Intergenic
915519903 1:156436121-156436143 GCCTCCGGCCGCGGGCGCGGCGG + Intergenic
917659610 1:177164595-177164617 GGCCACGGCCGCCGGCGACGTGG - Exonic
917846727 1:179026130-179026152 GACCCCCGCCCCCGGCGCGGCGG + Intronic
922440734 1:225653268-225653290 GGGCCCGGCCGCCGGCGCGGGGG - Intergenic
1063664717 10:8054463-8054485 GAGGGCGGCCGCCGGCGGAGGGG - Intronic
1065023082 10:21516865-21516887 GGCGGCGGCGGCCGCCGCGGGGG - Exonic
1065102054 10:22340882-22340904 GCCGGCGGCCCGCGGCGCGGAGG + Intergenic
1066464403 10:35640340-35640362 GGCGGCGGGCGCGGGCGCGGCGG - Exonic
1066464557 10:35640921-35640943 GGCGGCGGCAGGCGGCGCGGCGG + Exonic
1070179233 10:73998341-73998363 GCTGACGGCCGCCTGCACGGCGG - Exonic
1072089638 10:92115042-92115064 CCCGGCGGCCGCGGGCGCGGGGG + Intronic
1072926590 10:99621388-99621410 GATGACGGCCGGTGGCGAGGCGG + Intergenic
1072950137 10:99840175-99840197 GGCGGCGCTCGCCGGCGCGGCGG + Intronic
1076554243 10:131311652-131311674 GACGGCGGCGGCGGGGGCGGCGG + Exonic
1077063425 11:627311-627333 GCCGAGGGGCGCCAGCGCGGCGG - Intergenic
1078102412 11:8337630-8337652 GACGACGGCGGGGGGCGGGGGGG + Intergenic
1081784966 11:45739224-45739246 GGCGGCGCTCGCCGGCGCGGCGG + Intergenic
1083454769 11:62771434-62771456 GACGACGGCGGCGGGGGCGGTGG - Exonic
1083952015 11:65961828-65961850 GACGGCGGCGGCCGGCACCGGGG + Exonic
1084180607 11:67443704-67443726 GCCGACGGCGGCCGCCGCAGAGG + Intronic
1085593669 11:77789443-77789465 GACTACTGCCGCCGGGGCTGAGG + Intronic
1088094145 11:106078022-106078044 GGCGACAGCAGCCGGCGCTGCGG + Intronic
1095439332 12:42227125-42227147 GGCGGCGCTCGCCGGCGCGGCGG - Intronic
1096022496 12:48333813-48333835 GGCGGCGCTCGCCGGCGCGGCGG + Intergenic
1096336926 12:50763976-50763998 CAGGACGGCGGCCCGCGCGGAGG + Intronic
1096495460 12:52037166-52037188 GCGGGCGGCCGCGGGCGCGGGGG + Intronic
1097007865 12:55931950-55931972 GGCGCCGGGCGCGGGCGCGGCGG + Intronic
1097648139 12:62260608-62260630 GGCGGCGGCCGCCGGGGCAGCGG + Intronic
1102053619 12:109880427-109880449 GACGGCGGCGGCCGGGGGGGCGG - Exonic
1102578377 12:113871811-113871833 GGCGGCGCTCGCCGGCGCGGCGG - Intronic
1103309015 12:119989678-119989700 GGCGCGTGCCGCCGGCGCGGGGG + Intergenic
1104602652 12:130163492-130163514 GACGGGGGCCCCGGGCGCGGCGG + Exonic
1113311920 13:109140599-109140621 GACGACGGCGGCCCGGGCGCGGG + Exonic
1117920802 14:60723834-60723856 GGCGGCGGCGGCCGGAGCGGCGG - Exonic
1121050490 14:90816451-90816473 GGCGGCGGCGGCGGGCGCGGCGG + Intronic
1121369903 14:93347365-93347387 GACAGGGGCCGCTGGCGCGGGGG - Exonic
1122151881 14:99730187-99730209 GGCGCCGGCCCCAGGCGCGGAGG + Intergenic
1122917488 14:104865671-104865693 GACCAGGGCCGCCTCCGCGGCGG - Intronic
1122964035 14:105112745-105112767 GGCGGCGCTCGCCGGCGCGGCGG + Intergenic
1125658992 15:41381884-41381906 GGCGGCGCTCGCCGGCGCGGCGG - Intergenic
1128398646 15:67254683-67254705 CACCACGGCCGCCGGCGCGAGGG + Exonic
1128582084 15:68817835-68817857 CCCGACGGCCTCCCGCGCGGAGG - Intronic
1129428262 15:75480757-75480779 GGCGGCGCTCGCCGGCGCGGCGG - Intronic
1130115627 15:81002184-81002206 CGCGACGGCCGCCGGGGCGGCGG + Exonic
1130370996 15:83284921-83284943 CTCGCCGGCGGCCGGCGCGGAGG + Intergenic
1132582282 16:690382-690404 GACAGCGGCTTCCGGCGCGGCGG - Exonic
1132609357 16:807564-807586 GAAGACGGCCGCTGGCGGGACGG - Exonic
1132799954 16:1747117-1747139 GACGGCGGCCGAGGGCACGGAGG - Exonic
1134529889 16:14975086-14975108 CCCGCCGGCCGCGGGCGCGGGGG + Exonic
1136641526 16:31569345-31569367 GACGAGGGCGGCGGGCGCCGGGG + Intergenic
1137412930 16:48244635-48244657 GCCGCCCGCCGCCGCCGCGGGGG - Intronic
1138247699 16:55479562-55479584 GATGATGGGCGACGGCGCGGCGG - Exonic
1139917809 16:70439031-70439053 GACGACGGCGGCGGCGGCGGCGG - Intronic
1141830123 16:86505736-86505758 GGCGGCGGCGGCCGGCGGGGCGG + Intergenic
1142143145 16:88481437-88481459 GTCCACGGCCCCCGGCGAGGAGG - Intronic
1142206306 16:88784807-88784829 GACGACGCCGGCCGGGGCGAGGG - Intronic
1142683289 17:1562475-1562497 GGGGACGGCCGCCGGGGCGACGG - Intronic
1143099868 17:4499071-4499093 GGCGGCGGCGGGCGGCGCGGAGG + Exonic
1143483405 17:7239476-7239498 GCAGGCGGCCGGCGGCGCGGGGG - Exonic
1145205654 17:20983966-20983988 GGCGGCGCTCGCCGGCGCGGCGG - Intergenic
1147963171 17:44179968-44179990 GGCGGCGCTCGCCGGCGCGGCGG - Intergenic
1148603037 17:48908533-48908555 AACGGCGGGCGCCGGGGCGGCGG + Exonic
1148742760 17:49902069-49902091 GGCGAGGGGCTCCGGCGCGGCGG + Intergenic
1149858081 17:60102667-60102689 GCCGCGGGCCGCGGGCGCGGCGG + Intergenic
1149908714 17:60550800-60550822 GGCGGCGCTCGCCGGCGCGGCGG - Intergenic
1152728741 17:81959955-81959977 GAGGACCGCCGCCCGCGCCGAGG - Intronic
1153565610 18:6414728-6414750 GCCCACGGCCGCCGCCGCGCGGG - Intronic
1153805385 18:8705594-8705616 GACGACGGCGGCGGCGGCGGCGG - Intergenic
1157849134 18:51030707-51030729 GACGACGGCGGCGGCGGCGGCGG + Intronic
1159040559 18:63319988-63320010 GCTGACGGCCGCCGGCAGGGAGG + Exonic
1160725599 19:616638-616660 GGGGACGGCCGGGGGCGCGGAGG - Exonic
1160864570 19:1251094-1251116 GGCGGCGGCCGCCTGCGCCGGGG + Intronic
1162341894 19:10096296-10096318 GGCGGCGGCCGACGGCGCCGTGG - Exonic
1162886678 19:13702726-13702748 GGCGGCGCTCGCCGGCGCGGCGG - Intergenic
1162953540 19:14085754-14085776 GCGAACGGCCCCCGGCGCGGCGG - Exonic
1163243114 19:16076412-16076434 CCCGACGGCAGCCGGCCCGGGGG + Intronic
1163420644 19:17211963-17211985 GACGACGGCCTTCGTCGTGGAGG - Exonic
1164191894 19:22925473-22925495 GGCGGCGCTCGCCGGCGCGGCGG - Intergenic
1164653354 19:29901751-29901773 GGCGGCGCTCGCCGGCGCGGCGG + Intergenic
1165349776 19:35269271-35269293 AATGGAGGCCGCCGGCGCGGGGG + Intronic
1166261424 19:41644196-41644218 GGCGGCGCTCGCCGGCGCGGCGG - Intronic
1166857992 19:45792735-45792757 GATGGCGGCGGGCGGCGCGGAGG - Exonic
1168064038 19:53909378-53909400 GACGCCGGGCTCCGGGGCGGGGG + Exonic
1168277102 19:55284386-55284408 GGCGACGGCCGCAGGGGGGGCGG + Exonic
1168339252 19:55614208-55614230 GTCGCAGGCCGCCGCCGCGGGGG - Exonic
925609636 2:5692514-5692536 GACGACGGCCGCCGGCGCGGTGG - Intergenic
927964733 2:27262092-27262114 GACGGTGGCGGCAGGCGCGGGGG + Intronic
930872755 2:56184630-56184652 GAAGGCGGCCGGAGGCGCGGCGG + Exonic
936038322 2:109129642-109129664 GGCGGCGGCCACCGCCGCGGGGG + Exonic
936141788 2:109947601-109947623 GAGGACGGGCGACGGCGGGGCGG - Intergenic
936178476 2:110245549-110245571 GAGGACGGGCGACGGCGGGGCGG - Intergenic
936202902 2:110423883-110423905 GAGGACGGGCGACGGCGGGGCGG + Exonic
936545973 2:113393767-113393789 GGCGGCGCTCGCCGGCGCGGTGG - Intergenic
939969618 2:148644820-148644842 GGAGGCGGCCGCGGGCGCGGGGG + Intronic
947641052 2:231708094-231708116 CACGACGGCTGCCAGCGCGGGGG - Intronic
1172350076 20:34231385-34231407 GGCGGCGCTCGCCGGCGCGGCGG + Intronic
1174607025 20:51768435-51768457 GCCGGCGGGCGGCGGCGCGGAGG - Exonic
1175887913 20:62302819-62302841 GAAAAGAGCCGCCGGCGCGGGGG + Intronic
1176548455 21:8211862-8211884 GACGACGGGCCCCGGCGGGGAGG - Intergenic
1176548601 21:8212241-8212263 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
1176556349 21:8256070-8256092 GACGACGGGCCCCGGCGGGGAGG - Intergenic
1176556495 21:8256449-8256471 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
1176567386 21:8394897-8394919 GACGACGGGCCCCGGCGGGGAGG - Intergenic
1176567532 21:8395276-8395298 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
1176575288 21:8439112-8439134 GACGACGGGCCCCGGCGGGGAGG - Intergenic
1176575434 21:8439491-8439513 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
1183601753 22:38844052-38844074 GAAGACGGCAGGCGGCGGGGAGG + Intergenic
1183841650 22:40502762-40502784 GGCGGCGCTCGCCGGCGCGGCGG + Intronic
1203253339 22_KI270733v1_random:128167-128189 GACGACGGGCCCCGGCGGGGAGG - Intergenic
1203261393 22_KI270733v1_random:173245-173267 GACGACGGGCCCCGGCGGGGAGG - Intergenic
1203261539 22_KI270733v1_random:173624-173646 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
950729859 3:14947836-14947858 GCGGGCGGCCCCCGGCGCGGAGG - Intronic
950743024 3:15064863-15064885 CACGACTGCAGCCGGCCCGGCGG + Intronic
951898343 3:27632765-27632787 CCCGACGGCAGCCGGCCCGGGGG + Intergenic
952382923 3:32818308-32818330 GGCGGCGGGCGGCGGCGCGGCGG + Exonic
954080506 3:48210814-48210836 GGCGGCGCTCGCCGGCGCGGCGG - Intergenic
955297206 3:57746908-57746930 GGCGGCGCTCGCCGGCGCGGCGG - Intergenic
959042481 3:101438819-101438841 GGCGGCGCTCGCCGGCGCGGCGG - Intronic
959419607 3:106112683-106112705 GGCGGCGCTCGCCGGCGCGGCGG + Intergenic
960628339 3:119703005-119703027 GGTAACGGCCGCCGGCGCGCAGG - Exonic
966594319 3:181712319-181712341 GTCGGCGGCCGCCGGCGGGCCGG + Exonic
966594349 3:181712434-181712456 GCCGCCGGCCGCCGCCGCGGTGG - Exonic
967118397 3:186361919-186361941 GACGGCGGCCGGCGCGGCGGAGG - Intronic
967118398 3:186361922-186361944 TAAGACGGCGGCCGGCGCGGCGG - Intronic
968701594 4:2060284-2060306 GAAGACAGCCGGCGCCGCGGGGG + Intronic
969413282 4:7043239-7043261 GGCGGCGGTGGCCGGCGCGGGGG + Intronic
969413370 4:7043519-7043541 GCTGACGGCCGGGGGCGCGGCGG + Exonic
975342569 4:73258561-73258583 GCCGACCTCCGCCGCCGCGGGGG + Exonic
975779059 4:77819925-77819947 GGCCGCGGCCGCCGGCGCGAAGG + Intergenic
979349267 4:119627306-119627328 GGCGACGGGCGGCGGCGCGGAGG - Intronic
982042291 4:151408672-151408694 GACGGCGGCCACCGGCGCCCCGG - Intergenic
982616119 4:157637803-157637825 GGCGGCGCTCGCCGGCGCGGCGG + Intergenic
992105518 5:73447202-73447224 GGCGGCGGCGGCCTGCGCGGCGG + Exonic
992373700 5:76171026-76171048 GGCGGCGCTCGCCGGCGCGGCGG - Intronic
998095204 5:139392589-139392611 GACGGCAGCCGCGGGCTCGGGGG + Exonic
998374516 5:141682065-141682087 GGGGAGGGCCGCCGGCGCCGAGG + Intronic
1000985227 5:167858796-167858818 GGCGGCGCTCGCCGGCGCGGCGG - Intronic
1002341432 5:178518852-178518874 GGCGGCGCTCGCCGGCGCGGCGG + Intronic
1002524402 5:179807147-179807169 GTCGACCGCAGCCGGGGCGGGGG + Intronic
1002580873 5:180208939-180208961 GAGGGCTGCCGGCGGCGCGGCGG - Intronic
1003049414 6:2766048-2766070 GCCGGCGGCCGCCGCCGCGGCGG + Exonic
1004387928 6:15188413-15188435 GGCGGCGCTCGCCGGCGCGGCGG - Intergenic
1006492110 6:34396946-34396968 GGCGGCGCTCGCCGGCGCGGCGG - Intronic
1007674448 6:43581602-43581624 GGCGGCGCTCGCCGGCGCGGCGG + Intronic
1007752017 6:44076589-44076611 GTCGCCGGCCGGCGGCGTGGCGG + Intergenic
1015476519 6:133664256-133664278 GGCGGCGCTCGCCGGCGCGGCGG - Intergenic
1016400783 6:143677981-143678003 GCCGGCCGCAGCCGGCGCGGCGG - Exonic
1017672360 6:156779102-156779124 CAAGGCGGCCGCCGGCTCGGCGG + Exonic
1017717212 6:157221416-157221438 GAGAACGGCTGCCGGCGCCGCGG - Intergenic
1019298219 7:290099-290121 GAAGCCGGCGGGCGGCGCGGAGG + Intergenic
1021872128 7:25017921-25017943 GGCGGCGCTCGCCGGCGCGGCGG - Intergenic
1022095674 7:27139637-27139659 GGCGCCGGCCGCGGGCGCCGAGG - Intronic
1024521075 7:50304501-50304523 GGCGGGGGCGGCCGGCGCGGAGG + Intronic
1025840291 7:65140853-65140875 GAAGAAAGCCGCCGGGGCGGGGG - Intergenic
1025882770 7:65555112-65555134 GAAGAAAGCCGCCGGGGCGGGGG + Intergenic
1025890674 7:65647492-65647514 GAAGAAAGCCGCCGGGGCGGGGG - Exonic
1029640511 7:101816677-101816699 CGCCACTGCCGCCGGCGCGGCGG + Intronic
1029658504 7:101943479-101943501 GACGTCAGCCGCCGCCGCGCGGG - Intronic
1029728479 7:102424316-102424338 GACGCCGGCCGCAGGCACGGTGG - Intronic
1031899446 7:127392871-127392893 GACCGGGGCCGCCGGCGCGAGGG + Intronic
1031986551 7:128167708-128167730 GGCGAGGGCGGCTGGCGCGGGGG + Intergenic
1035508125 8:150639-150661 GGCGGCGCTCGCCGGCGCGGCGG + Intergenic
1036536889 8:9658350-9658372 GGCGGCGCTCGCCGGCGCGGCGG + Intronic
1038828419 8:31032733-31032755 GGCGGCGGCCGCGGCCGCGGAGG - Exonic
1042040039 8:64580742-64580764 GGCGGCGGCAGCGGGCGCGGCGG + Exonic
1042785090 8:72537372-72537394 GGCGGCGGCCGCGGGGGCGGAGG - Exonic
1043463988 8:80487049-80487071 GGCGCCGGCGGCCGGCCCGGCGG - Exonic
1047687103 8:127315846-127315868 GGCGGCGCTCGCCGGCGCGGCGG - Intergenic
1053256052 9:36616064-36616086 GGCGGCGCTCGCCGGCGCGGTGG + Intronic
1053457053 9:38241517-38241539 GGCGGCGCTCGCCGGCGCGGCGG - Intergenic
1055090865 9:72364383-72364405 CACGCCGGGCGCCGCCGCGGAGG + Intronic
1059210845 9:112513677-112513699 GGCGGCGCTCGCCGGCGCGGCGG - Intronic
1060064764 9:120495030-120495052 GGCGGCGCTCGCCGGCGCGGCGG - Intronic
1062363595 9:136198753-136198775 GACGCCGGCCGGCAGCGCTGGGG - Exonic
1203469739 Un_GL000220v1:111314-111336 GACGACGGGCCCCGGCGGGGAGG - Intergenic
1203469885 Un_GL000220v1:111693-111715 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
1203477560 Un_GL000220v1:155286-155308 GACGACGGGCCCCGGCGGGGAGG - Intergenic
1203477706 Un_GL000220v1:155665-155687 CCCGACGGCCGCCGCGGCGGCGG - Intergenic
1187067452 X:15854692-15854714 GCCGCGGGCCGCGGGCGCGGCGG + Exonic
1187281373 X:17860784-17860806 GGCGCCGGCCGGCGGGGCGGGGG - Intronic
1190024951 X:46913529-46913551 AACTACGGCCCCCGGGGCGGAGG - Intronic
1191618327 X:63190365-63190387 GGCGGCGCTCGCCGGCGCGGCGG + Intergenic
1192621065 X:72680811-72680833 GGCGGCGCTCGCCGGCGCGGCGG - Intronic
1195036336 X:100973423-100973445 GGCGGCGCTCGCCGGCGCGGCGG + Intronic
1200251653 X:154557286-154557308 GCCGGCGGCCCCCGGCGCCGTGG - Intronic
1200253860 X:154568970-154568992 GCCGGCGGCCCCCGGCGCCGTGG - Intergenic
1200263909 X:154635438-154635460 GCCGGCGGCCCCCGGCGCCGTGG + Intergenic
1200266114 X:154647130-154647152 GCCGGCGGCCCCCGGCGCCGTGG + Intergenic