ID: 925614329

View in Genome Browser
Species Human (GRCh38)
Location 2:5731228-5731250
Sequence GGAACCAGGAAATGGAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925614329_925614332 -3 Left 925614329 2:5731228-5731250 CCATGTTTCCATTTCCTGGTTCC No data
Right 925614332 2:5731248-5731270 TCCCTGTTTCCTCCTCCCCTAGG No data
925614329_925614340 13 Left 925614329 2:5731228-5731250 CCATGTTTCCATTTCCTGGTTCC No data
Right 925614340 2:5731264-5731286 CCCTAGGAGGTGTAAGTCTGAGG No data
925614329_925614343 28 Left 925614329 2:5731228-5731250 CCATGTTTCCATTTCCTGGTTCC No data
Right 925614343 2:5731279-5731301 GTCTGAGGAAGGATGTACACTGG No data
925614329_925614335 0 Left 925614329 2:5731228-5731250 CCATGTTTCCATTTCCTGGTTCC No data
Right 925614335 2:5731251-5731273 CTGTTTCCTCCTCCCCTAGGAGG No data
925614329_925614342 17 Left 925614329 2:5731228-5731250 CCATGTTTCCATTTCCTGGTTCC No data
Right 925614342 2:5731268-5731290 AGGAGGTGTAAGTCTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925614329 Original CRISPR GGAACCAGGAAATGGAAACA TGG (reversed) Intergenic
No off target data available for this crispr