ID: 925614330

View in Genome Browser
Species Human (GRCh38)
Location 2:5731236-5731258
Sequence GGAAACAGGGAACCAGGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925614330_925614342 9 Left 925614330 2:5731236-5731258 CCATTTCCTGGTTCCCTGTTTCC No data
Right 925614342 2:5731268-5731290 AGGAGGTGTAAGTCTGAGGAAGG No data
925614330_925614340 5 Left 925614330 2:5731236-5731258 CCATTTCCTGGTTCCCTGTTTCC No data
Right 925614340 2:5731264-5731286 CCCTAGGAGGTGTAAGTCTGAGG No data
925614330_925614335 -8 Left 925614330 2:5731236-5731258 CCATTTCCTGGTTCCCTGTTTCC No data
Right 925614335 2:5731251-5731273 CTGTTTCCTCCTCCCCTAGGAGG No data
925614330_925614343 20 Left 925614330 2:5731236-5731258 CCATTTCCTGGTTCCCTGTTTCC No data
Right 925614343 2:5731279-5731301 GTCTGAGGAAGGATGTACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925614330 Original CRISPR GGAAACAGGGAACCAGGAAA TGG (reversed) Intergenic